CR99905

CRIMIC CR99905

Gene CalpA

CG7563

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78997

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
TAACCAAGGTTTGTTCGGAAAATTGCTATGATAAGAACATTTTATTAATTAATCTTATGTCAACAGGTTTGCCTTATTGACATAGTAACGCCAAATCGTCAGGGAAAGATCCCTATGATAAGAATGCGAAATCCTTGGGGCAATGAAGCCGAGTGGAATGGACCATGGAGTGATAGCTCACCAGAATGGCGCTATATACCCGAGGAACAGAAGGCGGAGATTGGACTAACATTCGACAGAGACGGAGAGTTCTGGATGTCCTTCCAAGATTTTCTTAACCACTTCGATCGCGTGGAGGTAGGACTATTAATATTTCTTGGTGAAATATTTCATGATTCATTCGCCATGATTTTGTTCAGATTTGCAATTTGTCGCCGGACTCACTGACCGAGGACCAACAAAACAGTGGCAAGCGAAAGTGGGAGATGTCCATGTATGAGGGAGAATGGACACCCGGTGTTACAGCTGGTGGTTGCCGCAATTTCCTGGATACCTTCTGGCACAACCCCCAGTATATTATCACCCTAGTCGATCCTGATGAGGAAGACGAAGAGGGACAGTGCACCGTCATCGTGGCCTTAATGCAAAAGAATCGCAGATCGAAGCGCAATATGGGAATGGAGTGTCTGACCATTGGTTTCGCTATCTATAGCCTTAATGATCGCGAACTGGAAAACCGTCCCCAGGGTCTGAACTTTTTCAGATACAAGTCTTCTGTGGGAAGATCGCCGCACTTTATCAACACCCGCGAAGTACGTATACGGATATATCCAGGATATGGCTGCAATCACTTAACATATGCGTTTCTTATTTAGGTGTGTGCTCGCTTCAAATTGCCTCCTGGTCACTACCTGATTGTGCCTTCAACTTTCGATCCAAACGAGGAGGGAGAGTTCATCATTCGAGTGTTCTCAGAAACTCAAAATAACATGGAGTGCGTACAAGTAGACAATGACAATGAGTTTGTATATTAGAAATAATGAGGGGTTTCTATAACTAAAAGCTTCTTACGTGCAATATGTGGT CCTCTACACATTCCTGACAGATAAGTTGGTTATGCCATTTTTTAATCACTCCTCTTATATATATTTTTACCTGAGATTAACGCCTGCAGTATTCCAGAAACTCGAAATATATTTCTTCTAGATAAATTCAAATGTAATGTCGGTCTGTCTGTTACATGTTAAGAATAATTCTGATCAATATGAAGTTCAATTTTCTTAATTTATCAGTTATAAAAAGGGTGGCGGCAGCAACATAGTGAAATCTATTAACAAAGTTAAATTTTTCGGTTTATTTTTAACCCTTGTTTAAATTGTATTTTTGTCATGTAACGAGATATTTATTAAAGTAATAATAAAGGAAACTTCCACAACAATATACTTTTAAAAATGGACCCCAACAAATTAAGCTCATCTTGAAAATCTGCTTCTCAATACTCATTAGGCCATTCGAAATCCTTGTACTGTAAATTGTATTGTATTCCATTTGTTTCTCTATAAACGAATTGTTTTCCATTCATTTCAATATCAATCATTTCGCTTTTCACTCCCATCTAGAGAGAATGATGATCATGTGGGTTATGGCGGCAAAGCCGATACGGTAAGTTAACTGTGGTCAATGGGATCGGGATCGCTTATTCAGAAATTTCGCTTTAAAGATTACGCCAGGATTCCCAACACCCAAGCCCATCGATCCTCAGAAGGAGGGCTTGCGACGCCTCTTCGACAGCATTGCCGGCAAGGACATGGAGGTGGATTGGATGGAATTGAAACGCATTTTGGACCATTCGATGAGGGACGGTAAGGCTCGAGATTAAAAACTACTCAAATGGCTTTTCAAACAACGATTTCCTTTCAGATTTACCCAAACCAGTGGTTTTCAACCGTTTCTCCAATAACATGGCCTTTGAGACCCAGGCTGCTGGCCCTGGTGACGATGGAGCTGGCGCTTGTGGACTTTTATCCTTGATTTGTGGACCG


Search Again