CR99903

CRIMIC CR99903

Gene Ald

CG6058

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 short band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
CAGTGCTGCCACATCCAAGGAAAATAAGTGTTGTTTTCCTGCCGACAAATAAACAAAGCAGCAATAGTTCGAAAACTACGCATTCTAGAGCAGAGCAAATGGAGCAACCAGCAA CAAGTCGAGGGATTTTTGTTACAAGATCACCTAGAAATGTTCATTACTTCTACATACAACGTTTTTATCGATTCTAGACCTCGCCGAGTGTCCGAGTTGACTATGATGGATTCGGACAGTGACGAGGAGGACATCAAGAGCAATCACAACCTTAACTGCGCCATCCTAAACGATTCCTTTGTGCTGAGCCCATCCCAAGAGTTAACAAACAGCAACAGCAACATAACCACTCGTAGAACACCAAGTGCCGCCCCCCTTAAGCAATCCGATTCGAATCTCTCGTTCCTGGGAAGATTCAACGACATGGGCATCAATTGCAGCAGTCAAGGATCCCCTGTTGCGAATTCGGAAAAACAGGTGGCCAAAAAGACAGCACCCACGCTTCAAGCTGCACCAAGTGCCACCGAAAGGCGCCCACTCCAAGAGACAGAGACGCCACTGCGTAATGAATTACCCTCCACCTCGAAGACGAAGCCGGATGCAGACTTCATTACCCCCCAAGTACGAACAATTGGTTCCACACTGGCGGGAAAAAGTCGGAGTGCGGTGTCCAATGACTTCCGTGCGCAGAAAGTGCTCTTCCAAACACCTATGACCGTGAGTCGTGCTGCTCCAGTGGCCTCCGATAGCATAAGCTTCTCCCTGTGCGACACCATCACAGAAAGCCCGGACATTCCGGAGCCTCCGAAAAAGGCAGAACCACCAAAGAGTCAGCATCCTTCCAAAAAGTCCCTAGATCATGTTTTCCGGGAGTCGGACAAGGATAACGTGCCAGACAAAGTGGATAATGTGGAACCAAAGGAGCTGGTATCGATTCCCGCAGTTGCTGTACCTCCAGAGCAGCCTTCCCACAAGACATCTAATATTTTAAAAATCAAGAATCATGAGTATACGATTGATAAGAAACTGGGCTGTGGCGGCTCCAGCTCTGTTTTTTTGGCACGCCGATCGGATTCCGGAAA


Search Again