CR99902

CRIMIC CR99902

Gene 14-3-3zeta

CG17870

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence

Amplicon 5' Amplicon 3'
CTAAACTGGCCGAGCAGTCAGAACGGTAAGTGGTTCATCTTATAATAAAGTTCATCAACCTCACAGAACTTCAAAAGAACCCTACAAACTCATTTGGCAAAAGTTATAGTTGCACATAATATTTATTAATACGTAAAAAAGACATTCTTGGAAGTTATAAGAACTCTAAGATTTAACATTGTTTTCTGTTTTATTAAATCCATTTAAAATCATCTTCTAATGAACAATATATGTATCATTTAAGTTGTTCTTCAAAATTTAAAGAATGCATATATTTCTGTGATCTACATGACTAAATATTTTCAATCACTAATGGAACATTTTCTATGCAGTTACGATGATATGGCCCAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAATGAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTGAGTCAATCAATCACAGATTGATTAATGTCGCACTATAGATTGGAGTTCAAGTGCTAAGCTGTATGTTTCTGCCCCTTCTCCGGGTGTGTTTAACATGTCCAAACCAGGTCATCGTGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTCGCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTGGTAAGTGGTGGTCCGCAAGTCTGCGCAAGTCTCTTTCTGAAGGATTTATGGGGTTGTAATTGGTCCATCTAATTATTTTCATGCCCACAACTCACTTGGTTGTTCATCTGCATTGACGGTGATGAAGATGGCAAACCTGTCAACCGCCTAAATATATATATATATATATATATGTATAAAGACCTCCGCCCTTGGCAAGCTCAGCTGTCCGAGGGTGTTGGTTGGATGGTTCAGTGGGTTTTCCAGAGGGTGGGCCTGTTTTCTGGTCTTCCTTCTTGCTCTAGTGAAATATAAAAATTTGTTACAATCAATAAATCTATTTTTAAAATGAACATGTTCCATTTTCCCCCACACACAGAGGTTTTCGCTTGTGTGTATATGAAATTTATATTGCCGTTCACGGATCAGA TCGCTTTTCTTTGATTGGGGCTTTTATATTGGATTAAACTTAACTGGTGCTTGATGGATTTTAAAATGGAAAATGATTTAGAACAAGGTTTACAATAAGCCTGGCGGCTTACTTGGTTAATTGTTGCGTTTGGTTTTCGAAATTGATATGAAATTAATTGGAGTACTTGTTTCCTTTGCTTACAGGGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTACCTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAGATGCACGCAACAGTAAGTATCTTGTCAAGCACACCAACAAAAACACCCTATCCCCGAATTGTACGCCCGAATTGTACAATAATAAAATCTTTACAAACCAAACTACAAATACTCTTGCAAAACACAGCCGTTGTCGATGACTCGCAAACCGCTTACCAGGATGCATTTGACATTAGCAAGGGTAAAATGCAGCCAACACATCCCATCCGTTTGGGTCTGGCCCTTAACTTCTCAGTCTTCTACTATGAGATTTTGAACTCACCAGACAAAGCTTGCCAATTGGCTAAACAGGTTAATAACACACTGAGACTTGGCTCGATTAATCGAAATGTATGGCAAGCGAGCAAGAAAGGCACACAAAATCCCAATCCGTCGATATTAAAGAACTTTTTTGTTTACTCTCAAATGGTTTTCCTAACTTTTGGTTTTTATTTCTTACTTTTTTACATAACTAAATCATGTGTAAATCGTTAAGCCGTCGTTGATGACTCGAAAAATGCCTATCAGGAGGCGTTCGATATTGCAAAAACCAAAATGCAGCCAACACATCCCATCCGTTTGGGTCTGGCCCTTAACTTCTCAGTCTTCTACTATGAGATTTTGAACTCACCAGACAAAGCTTGCCAATTGGCTAAACAGGTTAATAACGCACTGAGACTTGGCTCGATTAATCGAAATGTATGGCAAGCGAGCAAAAGGCACACAAAATCACTATCCATCGACATTTAAGAATTTTTTTGTTTACTTTCAAATGGTTTTCCTAACATTTGGTTTTGTTTCTTACTTTTTTCCATTACTGAATCATGTGTAAATCATTAAGCCGTCGTTGAGGACTCGAAAAAAGCCTATCAGGAGGCGTTCGATATTGCAAAAACCAAAATGCAG


Search Again