CR99902

CRIMIC CR99902

Gene 14-3-3zeta

CG17870

Information

Donor Location Cytology FBti Stock number
pM142R:10105495..1010551746E6Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK short band

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
CTAAACTGGCCGAGCAGTCAGAACGGTAAGTGGTTCATCTTATAATAAAGTTCATCAACCTCACAGAACTTCAAAAGAACCCTACAAACTCATTTGGCAAAAGTTATAGTTGCACATAATATTTATTAATACGTAAAAAAGACATTCTTGGAAGTTATAAGAACTCTAAGATTTAACATTGTTTTCTGTTTTATTAAATCCATTTAAAATCATCTTCTAATGAACAATATATGTATCATTTAAGTTGTTCTTCAAAATTTAAAGAATGCATATATTTCTGTGATCTACATGACTAAATATTTTCAATCACTAATGGAACATTTTCTATGCAGTTACGATGATATGGCCCAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAATGAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTGAGTCAATCAATCACAGATTGATTAATGTCGCACTATAGATTGGAGTTCAAGTGCTAAGCTGTATGTTTCTGCCCCTTCTCCGGGTGTGTTTAACATGTCCAAACCAGGTCATCGTGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTCGCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTGGTAAGTGGTGGTCCGCAAGTCTGCGCAAGTCTCTTTCTGAAGGATTTATGGGGTTGTAATTGGTCCATCTAATTATTTTCATGCCCACAACTCACTTGGTTGTTCATCTGCATTGACGGTGATGAAGATGGCAAACCTGTCAACCGCCTAAATATATATATATATATATATATGTATAAAGACCTCCGCCCTTGGCAAGCTCAGCTGTCCGAGGGTGTTGGTTGGATGGTTCAGTGGGTTTTCCAGAGGGTGGGCCTGTTTTCTGGTCTTCCTTCTTGCTCTAGTGAAATATAAAAATTTGTTACAATCAATAAATCTATTTTTAAAATGAACATGTTCCATTTTCCCCCACACACAGAGGTTTTCGCTTGTGTGTATATGAAATTTATATTGCCGTTCACGGATCAGA TCGCTTTTCTTTGATTGGGGCTTTTATATTGGATTAAACTTAACTGGTGCTTGATGGATTTTAAAATGGAAAATGATTTAGAACAAGGTTTACAATAAGCCTGGCGGCTTACTTGGTTAATTGTTGCGTTTGGTTTTCGAAATTGATATGAAATTAATTGGAGTACTTGTTTCCTTTGCTTACAGGGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTACCTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAGATGCACGCAACAGTAAGTATCTTGTCAAGCACACCAACAAAAACACCCTATCCCCGAATTGTACGCCCGAATTGTACAATAATAAAATCTTTACAAACCAAACTACAAATACTCTTGCAAAACACAGCCGTTGTCGATGACTCGCAAACCGCTTACCAGGATGCATTTGACATTAGCAAGGGTAAAATGCAGCCAACACATCCCATCCGTTTGGGTCTGGCCCTTAACTTCTCAGTCTTCTACTATGAGATTTTGAACTCACCAGACAAAGCTTGCCAATTGGCTAAACAGGTTAATAACACACTGAGACTTGGCTCGATTAATCGAAATGTATGGCAAGCGAGCAAGAAAGGCACACAAAATCCCAATCCGTCGATATTAAAGAACTTTTTTGTTTACTCTCAAATGGTTTTCCTAACTTTTGGTTTTTATTTCTTACTTTTTTACATAACTAAATCATGTGTAAATCGTTAAGCCGTCGTTGATGACTCGAAAAATGCCTATCAGGAGGCGTTCGATATTGCAAAAACCAAAATGCAGCCAACACATCCCATCCGTTTGGGTCTGGCCCTTAACTTCTCAGTCTTCTACTATGAGATTTTGAACTCACCAGACAAAGCTTGCCAATTGGCTAAACAGGTTAATAACGCACTGAGACTTGGCTCGATTAATCGAAATGTATGGCAAGCGAGCAAAAGGCACACAAAATCACTATCCATCGACATTTAAGAATTTTTTTGTTTACTTTCAAATGGTTTTCCTAACATTTGGTTTTGTTTCTTACTTTTTTCCATTACTGAATCATGTGTAAATCATTAAGCCGTCGTTGAGGACTCGAAAAAAGCCTATCAGGAGGCGTTCGATATTGCAAAAACCAAAATGCAG
 

Search Again