CR92264

CRIMIC CR92264

Gene CG13699

CG13699

Information

Donor Location Cytology FBti Stock number
pM37-p23L:18154897..1816252275B13-75C1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band long band CCAACGCCAAGACATCAAGCCAAA CTTCATCCGAGTCTATACTCCTCC

Images

Construct Design Sequences

sgRNA sequence CAACTAAAGCCCCTGCAAAATGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GGCTTTTCCTCTGGCTCACT TGCAGGGGCTTTAGTTGTGA AGCCCATTCCATTCCACCG GAACCCCAACCAGGTACACC
 
Amplicon 5' Amplicon 3'
GGCTTTTCCTCTGGCTCACTGAAGAATTTGAAGAATCCGCCGCGATGATTGTTTAAATAGTGAATGATTTCCATCTGTTGAAGAAGAAGTTGAATGAAGATATAAGACAAACAATTAAAATAACGACAATGTTATCCAAAGTAGACGAGGTTTAGATAAAGTAATAGTTGTAAATTGATTTATTGATTTACATCATTTCTTTGGCTAAATATACAATTTTGTTGTGGAAAATAATGGATTTTTAAAAATTCTTGCATGTACTTAATATTATTTTATAGAGATACTTCGATCATATACCTCTATTACTTTGGATTACATACGTTGGCGTAGTTACTCACATCATTTTTAGGACACTTTAAGTAGGTCTGAATGCAACTTTTCTCTCCACCACTCAAACCAAGAAGTGCAGCTCTTCCATAAATAAGAGCAGGTGATGCTACTGGAAATCCAGCGAGGAAACTGCATTAAAAGGTAAATAGAATAAGTTATTATATCTTTACATAATCAATTTACAAATTAATGGCAATAAAAAGAGTTTAATACACGTTAGCTTAATGTATACATACTCTACAAGCACTTGGAAGGGTATAAAAGTAACTAAATACAAGTTGACAGAAGCCTAGCTAGATGTTCAGTAGCTGTGACCATTCCACAATGATGGCTACCCTAGAAGTAAAATTTCACCCCTTAGGCTTCTCCTATAGTTACACAAGTAATGCAACTCCATCTGCCCTTTGGACTCTCTCTAGGCCGCTTATAAAACTTAATTGACTCGAAGCCAAGAATTTGCCAAAGCCAAAACAATTTCAATTTACAATGGGTACTATCGCAACCCCCCTCCCATTTACCATTCTCCGCAGAAAATCCCCACCAGACGTATCTCATTTAATGGAACAATCAATATGGTCTGCAAGGCAGTAATGAAGTCTAATCCCATTTAACGCTGCACCACAGAACCAAGATGCCCCCATCTGCCGCAAAATGTAAATTTAATAATATTTACTCACAACTAAAGCCCCTGCA AGCCCATTCCATTCCACCGAAAACAAATTCTACAATAATTGCAAAAAAGGTAAAAAGATGTAACATTAAATGATAAAAAATAGAATTACAAAGTTAACTGTTTTGATATAATATAGGCAAATGTTCGTTGCAAAAGTAAAAGAGGTCCAAAATAATATTAAGCATTTTAGAATATTAGAATATATTAGAATATGTAACTATTAATTTATTTATAATTAAAAACCTTTAAGCTCTCAGAGTTATTTTGGATATTATATTTGTCTCTTATGAAAAGTAAATAAGAATTAAGGAAATATTATATTATTATTGTCTATTTTTCTCAGTGCAATCAGACTATTCTGCCACCCTTCTGATATACTCACTTGGTTATGGCCGGGGAGGTAACGAATCCGGGCAATTGGCCACGTAACGTTTGACCGGCAATCATCTGGCAGAGCACCTTGGGCACGCACTGCAAATCGTCGTTGCGAGCGATGTTCTCCAGTGCCCTAATGAGCTGTGTGTTGGGCGGTCGACTTCCTCCCAGGCCCCCGGATTGCTGTCCTGCTCCTCCTTGTGCGCCGGCGAAAGCGCCGAGGAGACTGCCTAATGGACTGGACGACTGCGTGGACGCAGAGGGGGAGCCACCGCCGCCCAGGAGGAGATTCGTAAATTGCGGTGCGTACAGCGAGGCCAGGGTGGCCAATCCGCCGCCCACACCGCCGCCGGAGCCACCGACACCCGGTGACTGAGTGGCAGGACGATAGTTGAACTGCTGCTGCGGCTGCTGGAAGTGCTGGGACTGCGGTGGTGGTATCTCGCCAATTTGGTACTCGTAGTAATTGTGTCCCGGCCTGGGCCGCTGGGGTAGTCCGGTCCCAGGAACTCCTGCTCCTCCATTCTGGGGATTGTACGGATAGTTTCCAAACTGCGTCTGAATCTGCACAATAAAAAAATATTGGTTAAGGGTTGCAAACTTAATATTATATAATATTTTCGCATATGTAGTTCCCTTATACTAATCCAATATGTATTGGTTTTTAGTTGGAAATAAATATCGTATTAATATTTTGTTATCCATATCTCTATATAATATATATGATTTTTCCTTGGTGTACCTGGTTGGGGTTC
 

Search Again