CR92249

CRIMIC CR92249

Gene lgs

Information

Donor Location Cytology FBti Stock number
pM37-p14:436957..443911102B8-102C1 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AGCAGAAGTTCTCCGAAGACCCTT GACTCGCTGGATGTACTGATACTG

Images

Construct Design Sequences

sgRNA sequence TTCCAAAAATCAGTAATCATTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GAGTTAGTCCAACCTGCCCC CGAGAGTGTGGTCCCGAAG CTGATTTTTGGAAGGGTATGTCC ATGTGTCTGCTACAGTGGGC
 
Amplicon 5' Amplicon 3'
GAGTTAGTCCAACCTGCCCCATGCCTATCCATGGCATACCGACGGAATTGTGCCGCTGTAACTTGTTAATCTTTAAAGGGTTTTTCATAAAAAAGTCTTCCAGGAAGCTTTTTGTAGCAGGCTGAGTGCAGTGATACGCAATAATAGTTTGAAATTGACCGCTTAAAACTGATTCGGCCCCTTTGTTGGCCAGCTGAGTTGAAAACACGAATATGTGATTTTGCTGTTGCATGTAATCCAAACAATTACTGCTACCCGAGGAGATTCCATTGGCGTTGGCAGTCAATAAATTTCCCGTCCCCGCTCCAACTCCGATTCCGGGTATTGGTCCTACTCCGCTTACTAATATGCTCGAAATTGCAGGATTATTTAAAGATTCATTGATAAAATCGGGATTCAACTGATTGCAGCCTTCCATGCTCATTTCGTCATTATTCATTGTCAAGGACGATCCTTTTTTTTCCGTGGTACTGTCGTTTGAAATTCTTTCAATTTTAACTATGTAAAATGAATAAATAAGATATTTATTAAAATACACCATAAAAAATTAAATAACTCGTAAATCATCTATATAAATCACTGCGGGCGGAACTCCACGTAGTGGTGAAGCGCGCCAGAAGAGTGTGAAGGCGACTTCTATATATACACGCAAAAATGGAAATCTGCTGTGATTGTCCGACCTTAATCGAATTAAACATTTTAACTGAAGTGTGATAATTTCTCATTTAATCAAAATTAAATCAAAAACCTGGTTAGTATTTGAAACCGTGGAATTCTGTTTTATAGGCACTTTCCAACTTAACCATTTGTTTTTCCAAAATATCGTAGAACAAATGTAGTTCCGCTTGAAGGGGTTTAATAAAATAATCACATTTCTTCTAAAATGAAAACTTCCTACAAAATTACACCCATTTTCCTAAACTAATCATTTTTAGTAGCGTGCAGTATCAGATAGCTCAAAAGGTTTTATAGTAGTCTCCTTCGGGACCACACTCTCG CTGATTTTTGGAAGGGTATGTCCTAATTCAAAAGGTTTTTAAATTCTAGTTAATTAATCAATTTTATTTTACAAATTAGAAATATTCGTATTTCCTAATTAAAATAAAATTAAAAGGCAGGAGATATCGCTATAGTAGTTCTTTGACTATCAAATAAAATTGGTAACTGACATTAATTCTTGTTATTTGCTTTATATGGATCTCTTAAAACTTACCCGGTGTAGCGGAGTTGTCCTGTGCATTACCAATTGAACCAAAACCAACAGGGGACATCGTTGGCGAATGATTTTCTCTTTCTTCTTTTTTCATATTTACTAAACTGCCTAAGACATCGGTGGGTTCTTCCTTGACAGTCAAACTGGATGTAGAACCTGTTTCGCAGCCGCCACCAGCTGCTTGACCTTTTGCTTTATTAGAACTTATTTCTGAAATGGGACATTAATGGTTATGGAATATTAGGACAGCTTTTAAATAAAAATTAGCTTTTACACCGCGTCTAGTAGCATCTGCGTAGCACGGCTATTCAAAATGCTTTAGCAGTTTAACTAAAAATTATTGTGACTATTATATCATTTCACTCAGCAAATTTTTAAATTAATATATTCTTAAAAGTACAGCAATTTTTTCTCAAACTAATTAGTTGATCCAATTTGAGGTCTTTCTTGAGATGTTTGAGTACATCTATGATATGCATTCCATCAAGATGAATTAATATTTTTATGAGCTTAATTACGGTTCCAAGAAAATGTCTGTTTTGATCCGAGCTTCGCGAGTTTTAGTCAAGTTTACAAGTTTAAAACTAAAATTGTAAGTATAGCAAAAAAAAAACAATTAAATGATTAACAAAGGTGAACGCCAATACATTTTAAAATTTTAAACCATTTGTAGGGCAGTCTTACCAGCTTCCTCGTCCTTCACACTACATTTGTTTTTCTTCGATTGCTCGTCACAATCTACCATCTGAGTAAGGCCCACTGTAGCAGACACAT
 

Search Again