CR92245

CRIMIC CR92245

Gene CG6983

CG6983

Information

Donor Location Cytology FBti Stock number
pM37-p13L:8443042..844937766C13Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band weak band CGTTGGTGAGCACTCGTAAGTTTG TGGGTCTAGACAAGCCAAGAAACC

Images

Construct Design Sequences

sgRNA sequence TGTGGCCAGCAAGCAGCGTATGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TATTGCTGGACGGTGTGCTT AGTTTTCATTTCGCGCTTCAC TGCTTGCTGGCCACAATTC AAGCGACTATCGACTCTGCG
 
Amplicon 5' Amplicon 3'
TATTGCTGGACGGTGTGCTTGTGTGTCTGCCCCCTAACTAATACTAATGCAGTTGCTACCCCCAGTTGGGGGGATGCCATAAAAAGGCCACCAATCGCCGTACGTGCCAAATCGACTATAGAATATATAAAATGCCATATGCAAAATGCAAATGCAAAAACGAGAACGAACTGCAAACATGCATAACAGTATTGTAAGTTATGTATTTCAGAATCCCTCTCGAATCAAAACAATTGAAACACCAACAAGACAAATATCAATAACGAACGCCTTGTGGGCGTTGGATGGCCACCCGGGAGCGGAGGCGTGGCAATAGCATCCCCAGCATTGCTACCTCATGCAACAAAAACAACGTGCCCGCAGGTTTCCCAACGAGTCTATAAATAGCCCGCCACATGAGGATTGCACAATTGCATATCACTTTATAGAATACATAACAATAAAAAAAATAGTGACTACCACAATGGAAACCTCCGCTGGCGGTAAATGCAATTTAATCAGCCCCATTCGTTGTTGTTGTTTTTTATCTCTGGGGTGTTGGATATCTAATTCTTGGGGCGGGCGCCAAATAAACTTACAATTAGCATTGCCCATGAAAACGCTGGGCAAACAATAAAAAGCTTTAACTCACAATTTGCATTTCTAGGCGATAAGCGTAAGGAGAAACAAATTTATTAAGTACTATACAAACAAACATGCACATTAGGTAAGCAAAAAATAATAATAATAAAAAAACAATAGTATAATAATTCTAAAGATCTGTTAATCACGTTTAAGCATTTCGTGTTTGCTTTCGCAATAATTTTATTATTCACCAAAATGGATCGAATATAACTGCCACTTGAAACTGCCGCTCAAAAACAAAAAAAAAAAAAATTCTGATAGCCGCTAATTGATGAAGAAAGTGTGTGAAGCGCGAAATGAAAACT TGCTTGCTGGCCACAATTCATTAACTTCTGTCAGGAGATCATAAATTAAAATTAATCTAAGACAATTTAAGCAGGCTGCAACAGGCTGATAAAAACTCGGGTCGAGCGCCGTTTGAAAAGCGATAAGCGAAACCCATTGAAGTCACGCGAATGGCGACAAAGTCGGCGAAATGGTAAAAATGGAAAATGGAAAACCATCGATTGCGGTGGCCAACAAAAGTGGGCGGTAGGTGGTCGAAATTGGCTTAGCTATGGCCATGAACAAATATTATTTTTAATATTGCGACAGAAAAGCAGGAAGAAGAGGTCAAAGAACAACAATTGGCGGAAATCGAATGTGTGAAGTGAACGGGAAGGAAATGGCCAAAACACTCGTGCACACATACACTTACTCTTACGCTTACTCACTCAAAGTTACACTTTTAATGTATCACATATATAATCAGACTTATTTCCCCCACTTTTTTTCAGTGCATTCCCAGCTGCATGTTGGTTTCTGCGCTAAGAAGTGCAGCTGTCCTGATTTGCAGAAAAGGTCAGCAAACAACAAGCGATTCCCTCGAGTGGCCTGACTTGCCTAAATTTAGCTCACTCTTTTCATTCTTTCTGTTCCAATTAAACCGAATTAATCGCCAAAATCCACGCGCAATTACCCCCACTTACCCTTTTTTTACCATCAACCAAAGAATCTACACCCCCCACCGCCGCCTTTTCCTAATGATATTTTAACGCACTTGAGCTGGTTTCTATGCAAATATTGGGCGCTACTTAATGGCCAAACAAATGAGTTGGGCAAATAACATCGGGAATCGGAGTTACTAATTTTTACCTTGATGCTCCACATTTTCAATGGACTCGTCGCACATTTTGAGGATCCGTAGATTCGCAGCTCTTGATTTGTTTTGGTTTTTTTTTGGTGGTAGTGTTAAATGCCAGCGATTTTGCGAACCCTCAGAATTTAAACAGACGACGCGCTTCTTTAGAATTTCCCGATTTTCGCAGCGAGGTGATTTAAATCAGAATCCAAAAACGACGAAAAACAAAATAAACAATAGTGGTGGTGCGTCGGTAGATTTCTTGTGGCTATCGATGTTAGGCGCAGAGTCGATAGTCGCTT
 

Search Again