CR92238

CRIMIC CR92238

Gene verm

Information

Donor Location Cytology FBti Stock number
pM37-p13L:19690033..1969526076C1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short and weak band no band CCTTTCTTCACACATCGCAGAAGC ATTCGACTTACCTGTACACCTCGC

Images

Construct Design Sequences

sgRNA sequence CATATCCCATTTATGGGCACAGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CATGTGCTGTTGGGATGGGA GCTTTCGTTTGCCCTTTCGA GGATGATCTGGGGAATGCTG CCAAGACACCTCGGCTTGAT
 
Amplicon 5' Amplicon 3'
CATGTGCTGTTGGGATGGGAAAGATGGTTAGGCATGGCTAATGATCGTTGGTGATCATTTAGATCAGGTTACTTGACTACATTGATTATGTGCATTTGTTTAGTTTCTAGCCATACCAACGTAGTTCTAGTCTCTGGACTTTAGTGCTTGCCTATGTTGGCAATGCGTTTTAATACGAAGTGTGTATACTTTCGATCGGAATAAACGGGAATTGGATGTTCGATCGGAATGATGTTAAAGGTGGTGTTTTCTGAACGAAATTCATTTGAAACTTTCCACAATTTTCCCTACACATTTGTAACCATCAATTTGATAGTTTAGTGTAAGAAGCTTGTAGCAAACTTTGCGAAAAAGTAAATAATGCAGTATTCAATTTATAATTTTCGTTGCTTTGTCAATTCTCATAATTACGTTTTCTTTGGTATCTCCTTGAAGGGTCCTGATCTATGGCGGGTTCAAATGAATTTTTAACATACAAGCCATCTGGTTGAATAGAAATGTTTACATATTATCGTGCCAACAAATATATTTTTTTAGTGTTCGGCGAGCACTGCTTAAGAAAATCTAATTTATTTTTGTTTTAATTTTTTAATAGAATAGAATAGGGACATACTGTCAGGAAGAAGAAGAGGAAATGTTTTCTGAAGAAATCGCCATGAATTTAAGCAGAATTGAAAAAAAAGTTTGAGATACGAGACAGAAGAGAAAACACCAGAGACTCTTTCTTTAATATAAGTACTTGTTATCCTATTTTAATTTAAAAGTCAATAAATACTCTAAAAAATATATAAATTAATATAAGTATTTGAAATCAATCAAGTTCTTTCCTAACTCCGTTCGCTGATAATTTGCCGACATCTTAATTGTTAAATTGATATTGTTCTCATTGGCAACTTGATCGTGATGGGTGCCATTAATCACAGTCGTTCTATCAGTTAATCGGCGTCTTAGCCAGTATAATTGGCCGCACCTCATGGCTTAACGGTTAACTTACTCCCAACACCAACGACTTTCGACCGGTTTTTGGCCATTGGTTTGTGTGGAAATACGAGTACCACTTCTAGCCGACCAAAACAACTCTCGGTTTTGTTCAATACAGTTTGTCTACATCTCGTTTCGGCTGAAATCGAAAGGGCAAACGAAAGC GGATGATCTGGGGAATGCTGGCGGATCGTATCGAATGCGGTATCTTACGGTAGCGGTTGGTCATGTAAGGTGTCTTTCCAAACGGGTTGAGAGTATTGGCTAACCGCGTTGTTGTTGTTGTTGTTGATGTTGATTTTGTGGTTATTGGAAACCCGTTTTCGGTTTAACATTAAAATGATATTGCATAAACAACGCTGGCGAGTCCAAAAATACATATGTACATATATCTACATGGAAACGGAACCGACGGCAGACAGCAGACAGGCTGGTTTTGTTCGTTTTCCAATGCTAATTTCGGTTTTATGGCCAACCGGAGTTTCGTCCTCTTGCCACAGTTTCTTTTTTCTTTATTATTATTTTTTTTTTTTTGTTGCTTTGTGGTTCGTTTTTTCCTTTTTTTCCGACAACTGAACTCTTACATCACCAGCGATTGAAGGATAAGTTTAATCGATTGCATGCCGCTAATGACTGCGACTTCGACTTCGATCAATTGTGATGTTTTTCGAGCCCACATCATCGCACTTTTTCAAGTTTATTCGCCTTGGCCAGCGATCGAGGTTCGTTTCAGCTAGTATTGTATTTTTTTTCTTTGGCAACCTTGCGAAAAGTGGCAAAGTTTCCACCGCCAAAGGTCACCAACTTAACTCTAGGCACAACTAATGGCTACCTACGTACTAGGTGTAATCGAACGGAGTACTCACCAACAGCAAGGCAGAGGCACACAACGCTCAAAATTGGCCACCAACGCGCCATGATAGATTCCAGAGCTCTCTGCGGGCGAAATTCGTAGAAGGGTTAGCAACACACTAGTCACAATTCCGTACTAATGATACTGATGGCACATAGTACGAGGTATAGGTTATAGGGTGGTAACTTTGGAAAACTCAACTGACTTTTGCCCAGACTCTGAGTGGGAATGCTTGGATCGAATGGAAGTGGAGTGAACGGAGCTCACTCTTCCAATACACAGCCACGCTTACACTAGGTGTTGGCCACCAGCAACGAGTTCTATTTATCAAGCCGAGGTGTCTTGG
 

Search Again