CR92233

CRIMIC CR92233

Gene Mdr50

Information

Donor Location Cytology FBti Stock number
pM37-p22R:14246966..1425259750E6Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short and weak band OK TCCTTCGCGAGTCATTCAGGTCAA TCAAGATCTTGGCAGCAACCACAC

Images

Construct Design Sequences

sgRNA sequence AAGCGTGGTCATTGTGTTATTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CGGTTTTAGTCTGCGTTGCC ATGACCACGCTTCGGTTTTG CAAACCACTTCCCACGGGG TCTCTGAAAAAGGCGGCACA
 
Amplicon 5' Amplicon 3'
CGGTTTTAGTCTGCGTTGCCATTGGGTCCTTCTCTTCACTCCAACGTATATTTATATATATATATATATATTGATATTGATATTAGCCCTTGAGTTATATATACACGATGACCGTTAAGAACGGCGATGTCGTCAAGGACGATGTGAATTCGCGATCGCAGTACAAAACGAACATCGTCCTGGGCGCCAAACTAGAGGATTCGGATCGAGATCGAAAGAGCTTGTGAGTTTTGAAAAGAAAGTCGTTAAAGGACATTCAAAGTTTGAAAGCGGGAAATCTGAATTTTGTGCTGTGCCAACGAAAGAAGAAAACTTATTGTGAAATTTTAAGGAAAATGGCTGTAATCTCAATTAATCTTGTTAATACCTATTGTCCTATAAGTAATTAAATCAATCGATACTCAAATGAATAAAAGGAAGAAATTATTTTATTAATTGACATGTTTCCGTCGAGTGCCCAATTCCATTCAAGTTGTTCACCTTTAACAAATTTGCACTTCAACGATGACGCCGCTGAATTTTCATACGCATTATTCAGCTACTAAGTGTATTTTAATTGTGTACCCTATGCGAAGAAGTTATACGAAATATCACATATTTTCAAGGATTTTTAAATTAAAGTTTGATCCTGAAATCAATGCTTTACAAGCTCTACAGATTTATAACCCACATAAACGATTTTATATATGTAGATTGTGTGTGAATTTGAAAGTTAGTAATCGAAATAGTAAAGTGTATTTGGCCTTCGTTATAGTATTCTAACAATTACAACTTTATCGTTCATTGATTGCCAATGAGTTAAACAAAAAAAAAAAAAAAAACTGTAGATAGTAAGTTCGTCGGGCAAAACCGAAGCGTGGTCAT CAAACCACTTCCCACGGGGAATGTTAGGTATAGATAAGCTTGGCGGCGATTGGTGATTGGCAGCACTGTGGGGTTCATGGCAATGGCGTCAATAGAATCATCGAACTGATAACCATCTATGATTGGCGTGCGCGCCACCCTTTATTATTATTGCAGTGAGCCCAACAAGTCGAAAAAGAAGTCCAAGCATGACGAGTCGGATGCCAGCGATGAGGAGGATGGCTCCCAGTACCATGAGGATGTCAAGCAGGTTAGCTACTTCCAGCTCTTTCGGTACGCCACCAAAAAGGATCGAGCGCTCTATGTGATCGGACTACTGTCTGCCGTGGCCACAGGCCTGACCACTCCGGCCAACAGTTTGATATTCGGTAATCTCGCCAATGTAAGTCAAAAATGCTGTTCCAAAATCATAGATCTTTATCTATTTATACATCTATCTTAATATCCAAAGGACATGATTGACTTGGGTGGACTGCTTGAGAGCGGAAAATCATATCGAGCTGACGATGCTATTTCTACTTTGCTTCTGGACAAAGTGCGGCAGTTCTCCCTGCAAAACACCTACATCGGCATCATTATGCTGGTGTGTTCCTATCTCTCGATCACCTGCTTCAACTACGCGGCCCACTCCCAGATCCTCACCATCCGCTCAAAGTTCTTTCGCTCCATTCTGCATCAGGACATGAAGTGGTACGACTTCAACCAGAGTGGCGAAGTAGCCAGCCGAATGAATGAGTAAGTGACTCACACATCTTATCAAATCTTTAGTTAATCACGGAATTTTTGTCATACGTAACCATACACCAAACAAGTCACACGTTTCTTATCAGTTGCTTTCAAAGTTACCATCTTATAAATAGTTAAAAAAAATCAAAGATATGCCAATCGAATTAAATGTGCCGCCTTTTTCAGAGA
 

Search Again