CR02522

CRIMIC CR02522

Gene CG44836

CG44836

Information

Donor Location Cytology FBti Stock number
int200-CR-p03L:16390952..1640027572E5Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
ok ok GCACCTGGCACATCAGTTTGATGT GCGATTCGAATCATTTGCAAGCC

Images

Construct Design Sequences

sgRNA sequence GATGGCAGTAGTAAACATTATGG
sgRNA2 sequence
 
left_200bp right_200bp
CCATTTTGCAGCTCCAGCGTCTGCAGCGCTCCACCAGCGCCAGTGCGATCCGTTCGCACCTGACCAAGGTGTCATCGACGTACCGCCGCCCCATCGCCTTCAATTTCGTTCGGCGCGAGTGCAAGCGTTTCTACGTCTTGCCCGTCTACATGGTGAGTGTGTTTCCCCCGTTGGATACCTTCTTTTAGGGTGCACCATAA TGTTTACTACTGCCATCCCCACACACAAACACACACCCTTCCACACTTATTGAATCCAATCCCCTTTCGATTCCAGCACAGCACCAAGCAGAGCATTCGATTATGGTGGCAATATGCCTACAAGTGCGTCACGCCCTCCGCCTCGGCCGGTGCCGTCTGGAATCCGAATCTGAAATTCCGGCTCTACTGCAGCCGGCAGC
 

Search Again