CR02445

CRIMIC CR02445

Gene Idgf3

CG4559

Information

Donor Location Cytology FBti Stock number
int200-CR-p12L:16450907..1645519436A1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK GCTCTGCGTGGAAGAGTTTCAAGA CACTCTCTGAAGCAACCAGTGTTC

Images

Construct Design Sequences

sgRNA sequence AACAAAGTGGCTTGTATCAGTGG
 
left_200bp right_200bp
GGTGACTGCACTGATCAAGGATTTGAGTGCCGCTCTGAAACAAAATGATCTGCTGCTCAGTCTCACCGTTTTGCCAAATGTGAACTCCAGCTGTAAGTATACAAACAACAGGCAATTACTTTGTTTATTCCGACGATCTGGTGTAATTTGATGAGTCAGAAAAGTTTTTTATTTGCGTTGTGTATCGATGAAACCCACTG ATACAAGCCACTTTGTTTAATTGGTACACAACTGTTAATTGTTTTGAAAGCAGCTGTTGAAACAGATTGTCTTAGAAAGAAGCAGGGAAAGAGTTATTATATAATGAGTATTAATGTATTACGGAACTAATAATTCAGTGCACAATTCCACTTTCTAGGGTACTATGATGCCCCGTCGATCGCCCCAAGCCTGGACTTTA
 

Search Again