CR02424

CRIMIC CR02424

Gene Idgf6

CG5210

Information

Donor Location Cytology FBti Stock number
int200-CR-p12R:16691022..1669375153D2Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK no band AAGAAGCACCTGGTCTGCTACTAC ATCCAACTGCTGGTTCAGACTCAC

Images

Construct Design Sequences

sgRNA sequence AAAGTAAATCTCACCGAGACTGG
sgRNA2 sequence
 
left_200bp right_200bp
ACTTACTTTGTAATATACTTTGCCCTCTTAAATATTATATAACCTCCAGTGGAAGTTGCTAATTAGCAAAAGTAAAATAAGAAAACGAAATCGAAAACAACGACTAGGCTTATCAACAAATACTCGGAACTCGATTTGTTTAGTTTGTTTGCAATTTGGGTCGAGTGTGGAAGCGATAATCGAAAAGTAAATCTCACCGA GACTGGTCGTAAATTTAAAATAATTGGCATAACTAAAAGCTTTTCAATTGCAACAAAAATGTGTGAAAGAAGTCTTTATTTAATTTTAAATAGATTTCTTATCTATTTGCCATAAACTATGTATTAAAATGATGACAGCACTATAAGACAGAATCCAGGGTTTTCCCAGTACGTAAATCCCTTCTCCTAATCGCCGAATC
 

Search Again