CR02394

CRIMIC CR02394

Gene mahj

CG10080

Information

Donor Location Cytology FBti Stock number
int200-CR-p02R:21625030..21631422 57F4-57F5Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence CATGAGGGTTCTCAGATCTATGG
 
left_200bp right_200bp
GGAGGATCAGCTACGCCGGCTAAGTCCCGCCACGCAAGCAAGTCCAAATCTTTCTCGCCAACATGCACCCAACAGCTCAATTGTTGGGGTGCGACGGCGGGCACGTAGACTGGGTGGCAATGGCAGCGGCAATGGCAGTGGCGGGAATGGGAATCTGAATCTTAATGGTGGTGGCGGAGTCGGAATCGGCGCTGCCATAG ATCTGAGAACCCTCATGCGGCGCATGGATGATATTGAACTAAATATTATGTCTATGCTTGCAGGAAGATGATGAGGAGGTGCCCGAATCTGATGAGGACGGTTCGGATACGGGCTCCGAGAACAGTAAGTTTGATTTTGATTATAATCATTTAATCCGTTGCTAAATCTCCTTACTCCCTAGCTTTTGCTATAGGTCAAA
 

Search Again