CR02365

CRIMIC CR02365

Gene stil

CG8592

Information

Donor Location Cytology FBti Stock number
int200-CR-p02R:12570367..1257188349B5FBti0214898 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GAGACGTCATAGTTCCTTGTTGGG GGCAGTGTTTCCACCGAGATGTTT

Images

Construct Design Sequences

sgRNA sequence GATTCTAACGGTAAAAGGCAAGG
sgRNA2 sequence
 
left_200bp right_200bp
CGGTTGCAGCCACAAGTACAGCTGCGCAGAGCGATTCCGGGGTGTTCGTGGACATGCAAGCTGCTGTTCCGTCTGGAAACGAAAGCCACGAGCTGAAAATCAAAACGGTTTTTCAGCGCCACAAGCAAGAGCAGGAGGGAGCTACCCGCAAGGTATGTTTTGGGTGGGCAGAAGCGAGATGTCGACATCTCTCACCTTGC CTTTTACCGTTAGAATCGAATACTGTATCTGTTCGGATAGCGAAATAGCTTAATGTATTGTTGTGACATGTATTGGTGAGCTTGATATCTCCGTTTTTTTCCAGCTCGAAGATTCCACTTCAGATAAAGCTAATCTACCAAATATCCCTAAGAACTTGGGAATTGTCGTTCAGAACGTAAGTTTCCTTTATTCGCAAATA
 

Search Again