CR02341

CRIMIC CR02341

Gene lok

CG10895

Information

Donor Location Cytology FBti Stock number
int200-CR-p02L:20061422..2006438138B2Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK lost CCATTGCGTGTGCTCCTCATGTAT CTTGCGAGTCCTTGTCGATAGCTA

Images

Construct Design Sequences

sgRNA sequence TAATTTGAATTCTGCTCTTGTGG
sgRNA2 sequence
 
left_200bp right_200bp
GGGGAGGCCAACGACTTGATCCTCACGCTCAACGATTTGCCCGAGAAAATCCTGACGCGCATTTCCAAAGTGCATTTTATCATAAAGCGGGCAAACTGCGAACTTACCAATCCAGTTTATATTCAGGTAGGTGGAAGTTCCAAACCCAAAAGCTCTGAAGGAAGCCTTGAAAAAAAAGATAGCAAATTCAGAACCCACAA GAGCAGAATTCAAATTAAGTTTTATTTATGTTTTGTTGAGATTATCAAAAAAGGTAACTTCAATATTGAATATTTCCCACAATTAATTTACAAAAAGAAGTTACTATTCCGTATAATTCCGTATATTATTAAAATGTAGTAACCTTGTTTCCGCCCATTTCGCAGGATCTCTCACGCAACGGGACGTTTGTGAATAACGA
 

Search Again