CR02339

CRIMIC CR02339

Gene heix

CG5876

Information

Donor Location Cytology FBti Stock number
2L:16296051..1629985835F1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short and weak band no band GACTGAGCACAGCCAGCAAAACAA CAGATCCGTCCATAGAGCATAGAG

Images

Construct Design Sequences

sgRNA sequence GCGAAAACAATATCAAGAATTGG
 

Search Again