CR02319

CRIMIC CR02319

Gene CG34430

CG34430

Information

Donor Location Cytology FBti Stock number
int200-CR-p02R:7943442..794447543F5Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
lost OK CTCAACATTGCAGCTACAGATGGC CGCACAGCATGTAGTGTGTATCGT

Images

Construct Design Sequences

sgRNA sequence GAATAAACTTGAGTCATGTACGG
 
left_200bp right_200bp
TGTATACGTGTTTCTACGTTTGGAGAGATTGGAGGAGACATGGGCCTTTCAACTACTTTGTACTGCTGCTGAGCACATTGATTGGATCCTTCAATAGGAGCGTATATCTACTTAATTTGGTGGAGACACATTGGGTAAGTCAGAGTTACTCCATTAGGACATCACAACACATTTGGTTTAAGTGAATAAACTTGAGTCAT GTACGGAGATAGAATAACTTTGCTATCTGTATTAAAGTGATATGACTTCTTGATTGCATGTATATACTACTGTTAATATATATACTGTTGATTACTTATGTTTTGTATTGCAGGTATATATTTATCCAGTCATTCTCATTATTGAAATCTTGGGTCTAATGCTGTATTCCTCCCAGAAGCGTTTTCGGTTTACCCAGATT
 

Search Again