CR02298

CRIMIC CR02298

Gene Cul3

CG42616

Information

Donor Location Cytology FBti Stock number
int200-CR-p02L:15265245..1527202435C5FBti0213533 91505

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK TTGTCCGCTCAGGGATTAGCTTCT CGCTGCTGCACATAAACTCTATCC

Images

Construct Design Sequences

sgRNA sequence AAATGCATAAGAGTGTAAGAGGG
sgRNA2 sequence
 
left_200bp right_200bp
CCTCTGGGCCATCAACCTCAGCTTCAGCGAGCGCAGAAAGTACAGAAAAACGCTTTAAGGAAATAGCACGGAAGTACCCACTCTGGCTACCGGAGTACAAGCGAAGGGCATTCAATGTTAGCCTACCATCTGATAAAAACCAAACAGGGATTTCAACTTTTAGTTAACTTACTAACAAGCGAAAGTCTTAATATCCCTCT TACACTCTTATGCATTTATAAGTTTTAATCCCTGAGAAATAAGTTCTTGACTATCCAAATTAATAATCTTATATTTCTCTTCCAGGCCTCCATGGACGAGAAGTACGTGGAGACCATTTGGGCCAGCTTAAAGAATGCTATCCAGGAGATACAGAAAAAGAACAACTCCGGACTATCGTTTGAACAACTCTACCGGAATG
 

Search Again