CR02282

CRIMIC CR02282

Gene hgo

CG4779

Information

Donor Location Cytology FBti Stock number
int200-CR-p02L:0..0

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
Lost Weak

Images

Construct Design Sequences

sgRNA sequence ACACCAACAAAATAAACTAGAGG
 
left_200bp right_200bp
AACTTTCTGTTTTTGAAAGTTAGACAGATTGTGCAGATAAGATATTAGAACAGTGTATCTATTGTCATATCATATTGTGAGATTTGAGTTAGTTTTCTAAACTAATGCATTGCGTGGCAAATATATAAATATGTACATGTTAATAAGTTATAAGTTGTAAAAAAAACAAGTTATCGTCTTGAATTAGTTTATTACCTCTA GTTTATTTTGTTGGTGTTTGGTGATAAAATTGATATTGATATGGCGTGCATTTTAAACTTGAAGAGGAATGTTACTCAAATGTATTTATTTTACATTATAGTACCTCTCGGGTTTTGGGTCTCACTTCTCATCTGAGGATGAGCGGTATCCCAACTCCTTGCCAGTGGGACAGAACTCACCTCAAGTGTGCCCATACAAA
 

Search Again