CR02238

CRIMIC CR02238

Gene fra

CG8581

Information

Donor Location Cytology FBti Stock number
int200-CR-p12R:0..0

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band No band

Images

Construct Design Sequences

sgRNA sequence CGCCTCACCCTGGCGTTCACTGG
 
left_200bp right_200bp
AAACAAACTAGTTGATTTTATAGAAGGATCCTACTTATACCGTGTACGAAAAACTCACGTGCGAGGTCCTGTTCCCATTTTCGTGCTTATTTGTGGCGCTCTGTGTTTTCACTTTCCTGGTCATATTTCCTCGCTCTTTAGCCCGTGAATTGTGGCAATTGTTTGATGTTGTCCTGGGCGAGTCGCCTCACCCTGGCGTT CACTGGCTTTTTCCCGTGGCCAGGAGCACATTTAGCCGCATTACGTGATACAATATATGAGTGACATGTTATTCTAATTTCGCACCCCTTTTCATATTCCTGGACACATTTTTTCCGCTCGTTCCGAGGGTGCGCTTGTCAAAATAAACATTTCCATATGGTGGTTATAGCCCCGGGGCTCTGTGTCGCAATGTGACAAA
 

Search Again