CR02237

CRIMIC CR02237

Gene l(2)k05911

CG31728

Information

Donor Location Cytology FBti Stock number
int200-CR-p12L:13251509..1325742634B1-34B2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short OK GGAATGAGAACTAGAGAAGCACGC GCGAGCACAGTGCACAAAATGCAA

Images

Construct Design Sequences

sgRNA sequence TTCTCTATAACTGGCGTAAAGGG
 
left_200bp right_200bp
GACATCGAAATACAACTTTTCTGATCTGACAGTAGAATTTATGCGAGGCACGCACCAAGCATTACTTGTATGACCTTCAGAAATCTATAAATCGCTTAAAGTTTGAGGGGAAAATGCGAAGTTTGGCTCATCGAGTAGGTGTACTCAACATTGTTTACCTTATACCCACATAGATGGCTTGTCGCTAGGCACTGCCCTTT ACGCCAGTTATAGAGAACTTTCTACTGCAAAAACAACTAGAACTCAGGTGGGCGTGCAATTTGAGATCAACTTCGTCGCTTGTCGATCGTGTTCCGTCGCCTGTCAATGTCCCCGCCAATCTATTACCTTTTATTTACGGCCAACAATTAGACAATTAGACAGCACTTTTGATGGAGAGGCGTGATCTGTGGTGATGTCT
 

Search Again