CR02234

CRIMIC CR02234

Gene CG4115

CG4115

Information

Donor Location Cytology FBti Stock number
int200-CR-p03R:12360008..1236325587B8Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long OK CAGGTGAAAGTGACTGATGATCGC CGTTGTAGAACTGATTCAGCAGGG

Images

Construct Design Sequences

sgRNA sequence GCGTAGGTGGGGGATTGATGGGG
 
left_200bp right_200bp
GACAGTATCGGGTGCGCCAGCTCCAAAAGGGCGCGGACTCGGATTCGGAATGGGAATGGGTATGGGTATATGGGTTCGCTTTCAGCGATAAAAATGGTTGTTTGGGCGTGACAGGCCCAAAAGAGTTGCTAACTGGAATTTCTACCACTATTTTGTTCGTCGATGCCAGCCCTGCATTTTCTTGCGTAGGTGGGGGATTG ATGGGGGAAATTTCTATTTCTATTTCAGTATCTGCAAGGGGCAATGAACTATTGATACTATTTCATTGATTCAGTTTCCTTGGATGGATATTTGAATTTTGTCCTGGTTTCAGTACATTAATGAGAACACTACTCTCACGTTGCAGGTGAAATACATCTGGACCAGCGGCCGCTTGTGTGACTTCAAGGGCTGTGACCGC
 

Search Again