CR02214

CRIMIC CR02214

Gene Ge-1

CG6181

Information

Donor Location Cytology FBti Stock number
int200-CR-p12L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence ATAATTAAACCATCATTCCCCGG
 
left_200bp right_200bp
TGTCCACCGCGATGGCAAGCACCTGGCGTACGCCATTAATGGTAAGTAATTTATATCCCATTGCAGTTTCTTGACCAATTAGATTTTATTTATGTGTGACAACTTTTTCTCGCAATTCTTGAGTTTTATAAAAAAGGAATGATTCTTGAATTTATCGATGGGAATCATGTCCCAATCAATATTTTACAGAGCTTCCGGGG AATGATGGTTTAATTATTATGTATACTTATGAACCCATTTACCTTGTGTTAATTTTAAAATTAATTTAAAAGCTATTGTATAATAACTTCATTGTGCTCCCAGTCAACAACAAAGCCACCGGAATGGAGGGCATGGTGCGCGTATGCAACATAGCCACCAGTATGCGAGCCTTGATCAAGGGAATGAGCGGCGAGGTCTT
 

Search Again