CR02208

CRIMIC CR02208

Gene CG14238

CG14238

Information

Donor Location Cytology FBti Stock number
pM37-p23R:26458249..2646098197B3Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAGTCACACAACGCACATCATCCT CGACGAGATTGAAACTGACGTGAC

Images

Construct Design Sequences

sgRNA sequence GGGTGCGGCCGCAGTGTTGGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GACTCCGCGTTTATCGTCCA GAAAGTGGGTGGCCAGGTTA CGCACCCCCACACTCAAA CACTCCTCCTTGTGATGCGA
 
Amplicon 5' Amplicon 3'
GACTCCGCGTTTATCGTCCACCGTTTGCCGTCTTAAAAGTCAGCTGAAGCATTTAATGGTCGTGGTGTGACTTGGAGGCACACATAAGTGAAACACGCATGGGTTCGATTTCGGTTGGGAAGACATTTCCAGGAGCGTCTTGGTCACATCAGAGTATAGAAAGTAAATGAAACTTAATTTCCCATATATTAAAATGGAAAAAAAAGGTTTTAAAATATATTAAGAAAGTTATTATTAGCTAGAATTTATTTAAGATCCATATTTTTTACTCTCTCCTTACTATGAAGAATCTTTACTTTTCGGTCTGCAGTTCGTCCCTGGACAAGCCGAAGATGATTCGTCCTGAACGCACACACAGGACATCGGGACGGGGGTCCGTGGCCATTCACCAATTACGCGCCATTCGCGGCTGTGTCCTTAATTTCTTAAAAAGCGTTTAAACATCTAATGAAAGCATTTGGGACCCCGCGATTTCTGCTGTCAGTTGCGTTTACCTTTTCGCCGTGTGCGGTTCGCTTCGTCGGTTCGGGTCGATTTGGTGGTATTCCTCGGTCCTGATTATCCGAGCTGCAGGAAGCGAGCACGAGAGGATTATGTCATTGCAGCCATGGCCAAGATAATCTCGACGATCAAGGCCATCCTCACGAGGATCATCTTCAGTGCGCACAGCCTGCTGGCCATTTGGCAGGTGGTGGCTTTAAAGAGTGATATCATATACTGGGCACTATGTGGACCACTGCTGTTGCTGCTGCTCGAGGGCATCTTCACCATCATGATCAAGAAGACGCAGGAGTGGCGCTGGTAAGGATGAAACCCACGGATCCTGGCTACCCCAGGCATCTGATTAAAACTCCCAACTCGAAATGTAAACAACAGTCAGTCGATGCTGACGTCATGCCGCGGGGTTTTGATTTTCAATTAAAAGTGAAATCATGTGTTTAATGTGTGCCTAACCTGGCCACCCACTTTC CGCACCCCCACACTCAAAAAAAAAGTAGCCACGATTTCCAAACAACACAATGTAGTTTACATAGGATTTTTGGATAAAAATATGCATATGAATTGAATCTAGAAATAGGAAATCCTATGAATTTTGTATCTTAAAGCCAATTTGTATTATCATTTCGGGGTGTACTTTTTTTCAAGTGTAAGCTGTCCACCTCACACTTTGTACTAGTAAAAACTTTAATGGAATTTCGTGGGGGATGGAGTCTTTTTGACTCTTGTTTACCTTTCGTCGCATCACTCAGACTTGTTGTTTGTTTTGGCCGTTCGGCTGTGCCACCTCATTTGTGTCCTTTGTCCGCAGGTTCTGCCCCTCGGTTTTCCTCTACCTGAGCAGCATTGTGCCGGCGATATGGCTGCTGGAGCTGGACAAGGTAGCACGTCGGGTGGGCAACATGACATCGACCAACTCGACGGTCTACAGTCCGAGCAACTACAGCATTCCCGTGGGCAACACCACCATCTTCATCACCAGCACCAACAGCAGTGGCGTGCCACCGGTGGCCACTCTGCTGGGTCAGGCCGGGGTCACCCTCTCGGTGACCCCGGACACTTGGACAACCCTCATCGAGCAGTTCCTCATGCTCATCCTGATCGTTGGTCGCTGGCTGCTGCCCAAGGGCGATCTAACCAGGGATCAGCTCAGCCAGTTGCTCCTGGTCTACATTGGCACGGCGGCGGATATTATTGAATTTTTCGATTCCTACAAGGATGACTCGATAGCAAAGATTGGATTCCTGGTCTTCCTTACACTGGGCATATGGTCCTGGAGCCTCATGCAGTTCACCATCGTGCTGTCCGCCACTCGAGGACGACGACCACGAGGCAGTGGATCGCATCACAAGGAGGAGTG
 

Search Again