CR02204

CRIMIC CR02204

Gene jagn

CG10978

Information

Donor Location Cytology FBti Stock number
pM37-p23R:5779315..578130883C3Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
TGTAGTTCCTGAGATCTCGACGTG GAAGTAACCATCCGTGGACGCAAA

Images

Construct Design Sequences

sgRNA sequence CTGCAGTAGGTGCCGCCTGCAGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TTCATCGCGACCCGTTCATT GGTGGATCTACTGCCACAGG ACCTACTGCAGCCGAATCG TCACAAGGCTGCGTATGTGT
 
Amplicon 5' Amplicon 3'
TTCATCGCGACCCGTTCATTAATCATTAATCATTACTAAATCTTACTAGTTCTGCCATTTGGTCTATAAGACATATTGGAATTGGAATGCAATTCAATTCATTTTAGTCTAGCGTTTGTACTTTTAGTAGAAATAATTCTCATATGGATGGAAGATTTCAATCGGAGTATTAAAACCAGCCCTCATTTTCTAAAATCGTGCAAAAAAGATATGAAAATTAAAGTATTAAGTGCCATTAATGCCATTAAGAATAGGTTTGGTTTTATTTTTCACCAGCCCACTTTTCAGATTAGCAATGCTAAACTCTCAGCATTACCTTTAAAAAATCGTTCTCATTTGCGACTAGTTCGAATATCTATCTACATTCTGCCGAAACTAACTAGAGAAAAACTGAAGTTCTACGTATGTAAGTATAACACATTTATTCTACACAGCATTAGCGAGGTTACACACCTAGCGAAGTCATCCTCCCAATTAAAATTTCCCTAAGCGGAGCTAGTCACCACGACCACATTGCCACTTTATTAAAACTAATAACTGTTTAATAACTGTAATAGAATAAGTTAAAATAATTAAATAATATGACTAATCACGTGTTGCTAATACAGTTAAAAGGCTAATTATTTAATTTAATTAATGTTTTGTAAACAGTTTCCATGCAGATGTATTAATAGTTTCCATGGCAGACTTTCTGAAAATGAACATTCTAAAACTTAGCGGAATTTCCCCTCTCTTTCTAACGGTTATTTGCTATGCTTTCAAGCGAAAGTAATCGATGGTAGCGAGGAGCGTATCGATGTGCGCCAGTTTTTTGGTGGCAGCGATGGTATCGCACACACATCGATTCTAGTGCCAGCCCTATTTTTTGTGCAATTATTTATTAAAAATAAGCAACGACGTGAGCGAACGACACGACCCACGAACGAAGGCAACGAAATGGCAACGCGCGGCGGACCAATGGTCGCGGGCACCGATGGCAACGACTTCGAGTTCAGGCAGCGCGTAGCTGGCACATATCAAATTAGGTTAATAACACTTCGTGCTATCGCCAGCTCTCAGCTACACTCGAAATTATCTAATTACTGGGGCGCCTGTGGCAGTAGATCCACC ACCTACTGCAGCCGAATCGCAGGTGGCGTCCAGCCAGGGCGGCGGAGCACCCTGGAGCTGCTGCACCCACCCACTTGCTGCTGTAGGGGGCGGGTGGGCAAAGTGCCAGCTGGGCAGCATGTGCGCCCCAATATGGGGCTCACCCACACAGATCCGCCACTGAACGACCACTTTCTCTGCTCTTTTAGCCTGCTGAACAAGTCCAGGTTGAAGTACTGCATCTTCTTTCACGCCCTGCTGTTCTTCGTGATGCTGGCCAAGCTGACGTCGGACATTCTGGACCACCTGGATATCTTTGTGCTGGAGATCGAGGAGCTGGAGGTCCCACCGCCCCTGTGGTGGGAGTACGTGTGGGCCGCGTCGTTGCTCACCTCCTTCCTGGGCCTTTCGGCCGCCAGGGGCAACAAGGTGCGCGAAATGCAGAAGTATATGGTGGCCATACTGCTATTCGCCATCCTGCCACTCTTCTACTGCTTCGCCTACTACTTCTCGGACGTGTGGGAGTTCGCCACGCTGGACAAGTCGGTGGAGCTGGACGAGACAGACATCTTTGTGTGGCGCGTAAGTGGCTGGGCCAGTTAATCCCTCAAGAGCCGCCCTACTAAACCTCGGTTTTTCTACAGGGTTATCCGTACGGCGTCTTCTGGTATGCCTTCTGCTTTGTGGGCTTCCAGGTGCACGGATTTACGCTGTACTTCGCCTACAACCTGGTCAAGGCCTGGAAGGCCAGAACTGCCACGCGCAAGTTCCAGTAATCTAAATACTCGCCAAACTAGTAAACGCCGGAATGCAGGGCTAGTTGTAAATAATTTGGAAACTTGAAACTAACTCAAAACACTAGTGCACAAAAGCGTAATGAAACTATGGTAAACTAAAGTTATGCAGCTGTTAAGGTATCGCACACTTAGTCATACAGGAAGGGAAACATATGGTCGAAACTGAGCGAAGCGTCGGCGGTAAGGTTATTGTTAGTTGAAAGTTAGTTGATACCGTTTTCAAATTGATTAAATAGACTCTTATCCATATACACATGTACACCTATACACATAGACATACATATATACACACATACGCAGCCTTGTGA
 

Search Again