CR02180

CRIMIC CR02180

Gene CG5646

CG5646

Information

Donor Location Cytology FBti Stock number
pM37-p13R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band OK

Images

Construct Design Sequences

sgRNA sequence AGGCAGTTCCCCTCAACAAGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CCAGCAGGTTCACACTGGAT GTTGAGGGGAACTGCCTCAG CTGCTGCATTGCGTCATGC TGCTTTCGAATCCAGGCAGA
 
Amplicon 5' Amplicon 3'
CCAGCAGGTTCACACTGGATCCGTCCGACTGACTGCGTCGCCGGCGCACAAAGTCCCGCCTGTCCATGTAGTCAACGCCCTGGCGATAGGCCAGCATATAGATTCCATAGGGCAGGACGTCGCTGTAACCAAACGACCATTGAAAGATTCATGTATTTTTGGACTACCACCTGGACTAACTTACCGGCACATCATGGGCAAAAGGCCGCGATAGAGCCCCGAGATGCCATCAGTCTTGAGTATCCTTTTGAACGTGCCAAAGGCGGTCCTTCTCTGGCCATACAGATAGTCACTGTAATCTACGGAATTTCACAAATTAATCCTCCATTTTGGGATTAAAAAATCAAGTAGAACCCACAAGTGGCTGTCTGCAGGCGAACCTTGATCAGCTCCATGGGACAGGCGATGAAGGACTGCACGAATCCCGCCACAGAGCCCGCCAGGAACATGTTGTGGTACTCCAGCTGCTCCCGCTGGTAGTCACTGTGGCACACCTTTCTCAGCTGCCGCAGATGGTTTCCATAGATGCCGAAAAGCAGCGAGTTGATCGCTCCCGTCGAGATGAACGGGAAGAACATGCCCCTGTAGAAGCCGTTGACCTTTGAGGCGATGCTGATCGATTAAACCCATCACGACCCACCTAGGCGCTCTAAGGGATTGCGTCCAGTCGGAGTCGGGATTAAGAATAGGACAAAGCCATTTTGGCTGGTTTAAATATTTGAAAAGTTATGAATAAAAAAGGAGATTGGAAGATCGACATGTACATCGTTATCCAAATATTTCACATAAAATTTGTATCCTTGAAAAAAAGTTTCCAACTAGACGCAATCCTTCTTTCCAAACTTACCCCATTATTTCTGCTGTAGATCTGTTGAATGGCTGTCACAACGGATGAATTTGAGGCCTGTTGCCAAACTTTGATCGTGTCGAGTGGGTGGGCCACCAGCACCCCGCAGGCACCTGAATATCAGAGTATAAAAATCAAGAATGCAGCATAAATTAATTAAAATTGTGGCCACAAAGTTAAACAACACATGTTGAACGGCCGCCGCCGCCGACAGCCGCTTGCCAAGAATCCGATGGATCAGGGGCGCCGCACGTGAACTTGACCATGGCGCCCGTTTTCCGCCGGGACTGAGGCAGTTCCCCTCAAC CTGCTGCATTGCGTCATGCATGGCCCAGAGTTCTGACCAAATTGGGATGAATACCAGCTGGAGCTCTGCCGCTCCGTCACTCACCACCAAAGCATCCGGCCACAAAGTCGCAGTAGTTCTCCCACTTCATGGATGCGGATTTTCAGCGAACGCTTGGAGTTTTCGGAAAATTGATTTTTCTCGCGATTTTCCAACTGCACCTCACGACGGCAGCGAACCAACTGCAGTGCACAGCTTTTGTGGCTCGGCAGCAAAGCTCTGCGATTTCGCCAGCTTTCCCAGCGAACAGAAGCTGATTGCTAAAAAATAGGCAAACCGAATGCTCACTTTTCAAAAAAAGATACTTTCTAACGAAAAAGTAACTCTGCTAAGCATAATGATATCTTGTGGGTATACAGCTCAAAACTATTCAGTTCTAAACTTAAAATTTTCAAACCAAACTTTCTAGAATTTTTCCTACGCATAGGAAAAAGAAGTGTAGAAAGTTTCTTAGCTTTTCACTTCAAGTTCAAAGGAATATAAATCCTTTAATTTTAAAAATACTATTTTGAATCCTATCTAAAATCAAACACGTTGTGTTAATTATTTTGTATTTATTAATTTTTTATTGTTGATTGATCTCTTTGCTTCTTTTCTCTCCGTTTGCTCATCATTCTCATTCATTCAGTTTTTGTGTGTTTTTTTTTTGTTTCATCTTTTACTTGGTTTTTAATCATTTTTGGTTAATTCTGCTTGCAGCTAAATATTTGTTTTTGCCTGCGCCATGCAATTTTAATTATTTTTTTTTCTGCTGCTTCTCGCCATTAGTTAGTTAATTTACTTTATTTTCGCATACTTTCTGCCTGGATTCGAAAGCA
 

Search Again