CR02177

CRIMIC CR02177

Gene CG42788

CG42788

Information

Donor Location Cytology FBti Stock number
pM37-p23R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK short

Images

Construct Design Sequences

sgRNA sequence TGGCACATGGATGCGGGACTGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CCCCAATTGAATAGCTCCTGGT CTGGGTGACTGCCACTGG CGCATCCATGTGCCATGTG CAAGGAGGGGAGGCTCTACT
 
Amplicon 5' Amplicon 3'
CCCCAATTGAATAGCTCCTGGTTGTTTTCCATACATAGCCGTTCTATTTATCTTCTGTATTTATAAATCATGCAAGAGCTCGCCCATTTGTACTTGACCCGCCTCCCACGTTGACCCTGAACCTGCGGTCAACTGTTGAACAGTTGCAGCCCCATTCCACAACCACCGGGAAAGCCCTTCGTGGCCACGCCCATCACAACAGCAGATGTCTGTTTAGCCCTGTGGGTGAGCTAGAAATGCATTCCAATTGACATTAATCAGAGCTAATTGGGTTATTTGCTCGACTTTGCAATAAACAGCAACCCATAATCGGGCCGCAGAGCTAAAACTAAACCTAGCCTCAGTCCACAGCCCGTTTAAAAGCCACTACAGTGGAGCTTCGAACAAGTGAACTATATAAATTTAAATTTGAAATTCTCTTCAATTCAGTTATGGTTTAATACTTCAAGTCTATAAAAGTGTTTACTAAAAACATAAACTACTTCATTTATAGGCTACTCATCGAAGCTCGACTGTGGCATCCCGGGCAGGTCCCGAACCCTCGGGCCAGAGCACCAGCCAAATCCAATTGCGACCCACATCAGCCACCACCTTGGTGGCTTCCGTTGCTGTCTTTCTTCATTTCCTGACTGCACACAATTGTGATAATTAGTTTTGCACTTTTGCACACTCTCGACGAGCGAAGGATTGGTGGTGGCGGCGGCGGGGGAATGGGTTTGGCTATGGGTATGGGCACCCAACATGGAATCCAAACGGCTATGTTCACTCATTCAGTCTATCGCCCCAGTGGCAGTCACCCAG CGCATCCATGTGCCATGTGCCGCCTCCGCTGCTCCCTGCCCCGTTTGCTTTCCACTCGGTTATGGCATTTTGTGCGCTTTCAGTTTGATGTGCAACAAAGTGTAAAATTATTTAATAGAATTTCGTGCATAATCAATTTATGTGCAGCAGAGAGCCCAGCATTCAGTCGCCCATTCAGCGTCCAAGCCATCTAGCCACATAGCCAAGCAAGGACCTTCCGTCAGTCAGTCAGTCAGTCAGTTAGTCAGTCAGTCAGGCAGTCTGTCATCCTGTGAGTTTTCCAGTTCGCCAGTGGGCCAGCATTGAAATGCTGAAACTTTGCCCATGCTAATGGCTAAATAAATGTCCGACTTTCTGCTTTGTTAAATATTCTTTTTTGTGCGTGGCGAAGGCAAAAAAAAAAAAAGTGGCGAGGTTATTAGAGTGGTTTTTGAAAAAACCACGAACGAAAGTTTGCCACAAATAATAAATGTTGCAGGGCAAAAAGAATTATTTTTAAGTTCACTTGTTAAAATGTAGACATTAAGCCTTTAAATCTTAGTTCCGTTTGCTAGATTTCTATTTATATATTTATTTCTATTGCTAGCTATATTTCTTGAACGCTTAATTGGCACACAGACCATACATATATCATTTAAAGTATCTCCAGAGTTCTGAAACGATTCCTAATTGCCAATGGAAATAAATTTCATTCTGTGCAGCAGTAATTTAAAAGTGCACAAAACTTTCTTAATTGGGCAAACTGGTAGCTAGTTTTATTCATATTGCACAATTTAAAACCATTAAAGAGTTTGCTGGCGTAATTCGAAAATATTTTTCAATGACATACTACGGTATCATATTACAGTATTATGCCATTTAAGTCATATTTTTCAATTTCCTGCGAATCTTATTCACAACTCACTTGCAATAGTAGAGCCTCCCCTCCTTG
 

Search Again