CR02153

CRIMIC CR02153

Gene pasha

CG1800

Information

Donor Location Cytology FBti Stock number
pM37-p13R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence AAAACCAGCCGCGAAGTTGATGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TGTCATGAGCCTGGTCACAC TGGCCATCTTCACGGAATATT ACTTCGCGGCTGGTTTTCC GATACGGTGGCGGAGTAAGG
 
Amplicon 5' Amplicon 3'
TGTCATGAGCCTGGTCACACTGTCTTGCACTAAATAAATTAGGGGGCGTCTTTAAATTGCAAAATTTCTTGCAAAATCAGTAGAAAAGTGCTTGGAGCTGCTGTTACAATAGATCCTAAGACCAAACGTTCTTCTCCGGAGGATAATACCTGGAACCATCACTAACCCCAATTCAAAAGTGTCAATCTGTTTCCGCAAAACTGCATGTGGTGTTTGTTTCGCTTGTTTGGTTATTTTTCCCAACTAACATCCTCTCTCTAAAATCTCGATTTCGTACTTGAATTGCGCAGCTTTTGCTTTGGGATTTTGTCCGACAATTAGGCAGAATCCATAGCGAAAGACGCAGCAAGTAGCATCGTTTACAATCCGCGAAAGTGCAGTCGCAGAATTTTCCGGCGGGGCTTCTGGCTTAACCAATGTGGCACTTCCAATGAGAAATCAATTGCAAGGCGTTGGATGCTCTCAGTATTGGTTATTGGCGAGATTGGCCCCGGGACAGCATTACTAGACAGTTCCGATCAGTCCGCACTAAACCCCTCCCGCTTTAGACACACACATCCAATACAATGGCGGAGAAGCCGCTGGCCGACTGCCCGGACTCTGGGCAGGTCCGCAAGCGTCCCCGGCTGGAGGACGAGGAGCAGGAGCTCAAGGTGGCCGGCTTTTCGCTGAGCGCCATCGAGGAAATGCGGCGGACCAGGGACAACGAGCTGCAGAACGAACCCATGGACCAGCAACTGCGACAGTTCCAGGTTCTCGACGAAGTCGGCTCTGGCAGCGATGAGGATGATGAGTCAGGTGAGTCGGAAACGAAGCTCGGATATTCACTCAGGTCATCCAGATCACAGGCTGTGCAATTACCACCTTTTGTTTCACAGTGCAGGCGCAGTTCTTATCTCAAGATCTTGGGGGCCTATCATTGTGCAAATACAGGAGGCTGATAAAAGAGTCAGCCGGCAGGTTAAACCCTGATATAGCAGCTTCAGTTTTCCTTTATCTTATTGTAAGGCAGGTGGTGGCAGTTTTGTGCGGACAGTTCCATGCGCATGATACCCATTATCCGACTGGCTTGTCCAGTTGCGTCAGGTAGAGCCAGTAATAATGAAGGATCACTTTAATTAAACATCAAAGAGCTAGACAATTAGGTGCCAATGGCATTCATTCAAATATTCCGTGAAGATGGCCA ACTTCGCGGCTGGTTTTCCATTTCCCAGACAAACAGACAACTTATTTATCCGTGATTGTATCTCCTTACATGGCAACCAGACAACGCTAGCGAGCAGCAGGGCGGAAGGTATGGAGAAGGAGGCGACGAGGAGGAAGAGGCGGCTGATGGTGACGGCGAAGAATACGATTCCTCGGAATTCGATGATGACGAGATCGAGAATCTGCTGGACGAGAAGCTGCCCGAAGAGCTCCGCGAGTCAAAGCAGCCCAAATACGAGCAGCGTTTCAAGACTGTGCTGGAAGGTCAGTGCTTTTCGTCGAACCAAGTGTCCAAGATGACGAGTATTTTAATGTGACTACTCTTTTAGAAAAGCGCCTCAACCACTTTGAAGTCCTACCCGAGGGATGGGTGCAGGTGACCCACAACAGTGGAATGCCGCTCTTCTTGCATCGCAAAACTCGCGTCTGTTGCGCATCGAGGCCCTATTTTCTCGGCACTGGAAGTGCCCGCAAGCATGCAGTGCCCTTGGGAGCAATCCCCTGTCTTAACTACAGGCGGGCTTTGGAGGAAGAGTCGGAGGTGGAGCAACAAAAGACGGATGGAGCGCCGCCAGTGGCTGTATGTCCCATGGCCGGAGCTTCCGCTTTACCGGCCGAAGCCATGGACGTGGAGGGAAAAGAGAACAACGAAGGCAGCACCGATTCCAAAACCCAACCAGATGGAATAACTGCCCTTATGCCGGCTGCTAAAATTGTTACGGTCAACGAGAATACCCAAAAGGAATCCATTACACCGGAGCAACTAAACACCTACTGCCAGAAACTCTTCAAATTCAAGGTGATTCGTGTGCTGCGATTTCGGAGTTGGAATGCTCGCCGCAAGTTCACCAAAAACCGCAAACACATCAAGAATATTCAACGACCCACGCTGCCGGATGGCACTAAGCTTATTAAGTTCCCAATACTAGCGAATGCTGGCGAAGGATCAACGAACCCGCGCGGTCGGAAGGAGTGGATCATGAATCCCAATGGCAAGAGCTTCGTCTGCATCCTGCACGAGTACGTGCAGCATGCTCTGAAAACGCAGCCCACCTATGAGTTCAAGGAGCTCCAAAACGCAGCCACGCCTTACTCCGCCACCGTATC
 

Search Again