CR02130

CRIMIC CR02130

Gene CG3308

CG3308

Information

Donor Location Cytology FBti Stock number
pM37-p13R:21271078..2127381793D2Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band short band CCAGGAGTACATTGCAGAAGTCTTCC TGTCGTTCAGTTCCATGTGGCTCCTT

Images

Construct Design Sequences

sgRNA sequence GCCCGACCTTCTGGCTGTCTGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CTTCGCCCACCTGTGTAAGT CCAGAAGGTCGGGCTATTGG CTCGCCCCAGAACGAAGAC AAAACTGAAGGTGGGGTCGG
 
Amplicon 5' Amplicon 3'
CTTCGCCCACCTGTGTAAGTACAACAATGAGCGTTCGGTGATACCAGTCTTCACGTGTTGCGGTAGCTTGGAAGCCCTTGTGTTTGGGTACATGAAAGGAGCATCCGTCTCCACCAGTAGTCTGTCTAGCGGCAATGTGCCGTCCTCCAGCAGGCGGCGAACGCCAGTATCCGATTTGTCCTTGCACAGGTAGCCCGTCAGGCTGATGTAGAACCTCCGGTCTAGGTACTTAAGCGCCTCCTCGGCGGTGCCCATAAAACCTCTGATGATCACAGGCGGAAGATTCTCGAATCTGCGCGGGGAACAATTTAAAGTTTTGTAAACCAAATCTACGGCTCTTACTTGTCTAGTATTTCGAGTAAATCGAGCTGAGCCGACCGCTCGTGGATCAGCAGAGGTTTATTTAGCCGGATGGCCAGATGCAGCTGCTTGGCGAAGATCTGCTTCTGGGCGTCCGGTTCGGAGAAGTCCCGCTGGTAGTCCAAGCCGCAGGGGCCAATCGCCACACACTCCTGCGCCTGGGCGATGTGCTCCAGATCGAACCACGTGGCCGGCTCTTCCACGATGGACTTGGAGTCGTGCGGGTGAATGCCAGCAGTTGAGTAGATTATGTCGGGATAGATGCGCGAAAGGCGCAGCGCTTCCTTGCTCGATTTGACCGAAGTGCCGTGAACCATTAGTTTCTGGACACCTGCAACAAGAAAGGCGGGAGAAAGTTAGTGCAACGTTCACTGGGCTACAGACTTGTGTACAAAAGAGAAAATATGTGACTTCTGTTTGCTTTCGATCAGATACTCTTATCAGCATTGTAATGTATCCCTTTAAGTAAATGTATTTAAAAAACAAATTTTTTGTTGAATATCAAATCAAATATGTAAAGAGAATTTATCTCTTACATATATTTAAATGTTTATAGTTTCCTTTAAAAATTTATCCTATGCAAATATTGTTGTGTTGACATCTTGGTTATTTGGTTTTTAATCTCCAGCTACGTTCCCATTGAATTTGTAATGCCATCTCCCAGGGCACATATGTACATGCATACATATATCAAAACACAGGCACACTTGTTGCTCGCCAATAGCCCGACCTTCTGG CTCGCCCCAGAACGAAGACACTGCCCGGGTCTTATTAATTATGCCTGCACATGTAGTATCTGATGCTGGCATACAAACCTGCGTCTCTGGCTCTCTGCACCACGGAATCCAGATCACGGCTATACTTCTTGTTGGTCAGATTCGCACCCACGTCGATGACGATCAGGTTCTCAAAGCAGTGCTTCATGTCCAATTCCAGCTGATCCTCCAGCAGCGGGGCCACGGGGGCCACCACCGTCTCCTGGGGCGTCTGTTGACTGGGGTCCATGTTCTGGATCGGAATCTTGGATCTATTATCGACGAAAATAGCTTATGACGCAGGCGATGGATTGCTGGGCTGCGACTGTGTGCGTGGGTAATTCAATTAGCTTGTTTTTGAGGGCGCAAGGAAACGCGACGGCGGTGAAAGCCGTGAAATGTGGATCTACTGAATTTGTTGGAATTTGGAAGAGTTGACCAATTCGGCAATCAATGGTCTAAAAGTTGAGAAATATTAATCTAAAAAACAATCCCGACACGAACTACAACTGCTGGCTAGAGTTGAACAACGTCTGCAGAACGGGTCAGTGCAGGTACTACACTCTGCATGCAATCGATAGTCGGAATCGATACGTAGCACCAAATTATATCGTGTTTGAATTTAAATTGTTATCAAAATAAATATTATGTAATAAAATTCAGTCCAATTATTTGATATAAATATATTTGTTTCATGTATATAGTAGAATTCCGATCATCAATAGTAACATCTTAAGACAAATAATTAAATATTTCACAATACCATACCAGAAGTCGCAACTAAATATAACTGAGTCGAATTTTTTGTTTCGGCAACAGTCATTGTTTTTGGGGATTTAAAACCCAAGCCCACACACTTGCACCGACCCCACCTTCAGTTTT
 

Search Again