CR02124

CRIMIC CR02124

Gene CG13618

CG13618

Information

Donor Location Cytology FBti Stock number
pM37-p13R:24524794..2452753396A5-96A6 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK long band AGAGATTGATGGGATGAAGCAGAGCG ATCCACCAGGCATTTGTCGAAGTTCG

Images

Construct Design Sequences

sgRNA sequence ATCTCTGTAAGATTCTCTAGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GTCCGGCTTAAGTGGTTCGA TTCTGGTCTGCAGGCCAA TGGCGTTTATAGTTGCATGCA AGGCACACATGACCTATGCC
 
Amplicon 5' Amplicon 3'
GTCCGGCTTAAGTGGTTCGATTTGACTTCCTCGAAGAGAGCGAAGCGTGAATATCGTATAAGCCATATATACCCCATATTATGGCCATAAATTATGTTGACAACCAGGTAAGGTTCAATGAACCGCATAGCGGGGGAAAATTAAATCGAAAGGGCAAACAACAGCAACGAACAGGGTTGCTGGGTGGCTCGGTCATTGGTCGTTGTCGTCACTTGTCTTCCACTTCCAGTGGTCATTGGTGGTTTGGCTATCTTGGCCTGGCCAAAAGCGGCGAGCCGGAAAGCAAAAGTGGTTCGCTCACTGGCTGGCTTAATGGGCCAAAGCTCGGCGCGATTGAAAATCGATGGGTTTTCGAGACTCGCAAAAGCTCTCCGACTTCCAACGTTCAGAAAGCCAACTTGAGGCGCCGTCGCCGCCGCTGAAGCTCGGTATAAAAAGACGATCGGCGGACGCATCCCGTGTACACAGTGATAAGTCTTCGGCCAGAACCACCTGTCACCTGAACCGAAAACGGAAGTCGCGCGCGCGTGTAGCCATCTCTTCGTGCCGAGTGTCAATTGAAATTTGGCTGTGGCTCTTGGTCAATCGATTTCGTACATCCGATCCGATTTCGTACATCCCCCCGGACGAAATATGTCAAAATACTCGCTACTACTAATGCTGCTGCTAATCGCTGCGGTTGCGCAGGAACTTACTGTAACGGCTGCGCAAGAATTGCGTAAGTACTGCACCCAAAAAAAAAAGAAAAAAATACAAATAAAAAACAAATAAATTAAGCAAATCGAACATCAACTATTGCGGCGAGTCAAAAGTGCAAAAAACTTATAGATCGTATTTGCTTTGGCGCTATGCTTCGGCTACATCTATTTGCTTGGCACCACATTTATGGTTAAAACGTGATCGATATGGCTTATGGCTCTTTAATTTCGTTTTTTTTCATTTGGGAACTCGCGTTTTGGCCTGCAGACCAGAA TGGCGTTTATAGTTGCATGCAAATTTGGAGTGTTATTACAGCAAGTACAGTAAAAATCAGTAGAGTCACGCCGGCTTAGACTTAAGTACTGCTTCAAATTGGGATTCTGGGATTTACCTTATTTATATACTGGATTTTTTTTACATTCTATACTTTTTAAAATATGCATGGTCAATTTCAGTTTAAGAAAGCCTGACAATTTCCCAGAACTGGAACTAATATTTATGTTAACGTTGCTGTAGATCCATAGAAATTGTATTTTTAAGTGTTTTCATGTACATTTTAAATACTTTAGAATCATGAATAATTACTTTTCTTGGTTTCAACATTAATCAAAGCTAGATTTAACTTTGAATCCCAAAAGAAATCCAGCAAGACAAATATGAACAATTAAAAACAATTAGCGTGGGAATCACCGAAAAGCTAAATAAAATTATTTTCCATGAAACGATTAAAAATGCGATGGGCTATTTCCAAGATAATAGTTTTGGCAATTAAAAACGAGAATAATTGAGGGGAGATATAAAAAAAACAAGCGACCATAAGACTTTATGCGCTTCATTTGCGTGCTGCTAAATGGTCAAGATCAATTAAGATCGGTTTTTTTTGGCAGCATTAGAGGTTTCCAGCTACTGAAGTCCACTGTAAACGGCGGTTATGCAATTGAAGCCATCGTCTGCAAACAGGTTGCTCTTGGCCAGGCCAGTTTGGCGGTCCAGACACCACAGGCCACAGTCCAGTGATCCACATTCACACTTACACTTCCGCTTGTGACACAAATTTACGATTATCGCAGAGAAGGACATACATATGTACATATGTAACCGAATGGCGATTAAATTGTGTTAATTAATTCGCACATTCCACGCCGCAGCACGGAATTTTTATGGAATTTTTCTCGCTGTGTAGCTGATTAATGAAACCGTTGGCATAGGTCATGTGTGCCT
 

Search Again