CR02112

CRIMIC CR02112

Gene tsl

CG6705

Information

Donor Location Cytology FBti Stock number
pM37-p03R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse

Images

Construct Design Sequences

sgRNA sequence GCTCATTCTAACGACAAACGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CAGCGACTTGAGGTCCAACT TTGTCGTTAGAATGAGCGCT ACGTGGCGGAAGTGAACAA ATCGCCCGTTTATGGAGTGG
 
Amplicon 5' Amplicon 3'
CAGCGACTTGAGGTCCAACTGCAGTATGGCATCGTTGCCGAGCAGCGAGTCCAGGGATCGCAGTAGAGTACTATTACCGTGCAGTTTCAGCAGGGTCACATACTTGACCACATAGTACTCGTACTGCAGCTTCCTTCTCGCCCATCTTTCCACTGTAGCATTGGCACTAGCCGATCGAATCTGGCCCAGATGGGCGGCAAACCAGGGCGCAAAGTAGTTGTAAAGATCCAACTTGGACAGTCCGTTCAGACCTTTACTCTTGATTCGCTCCTTGATCATGCTGTAGTTCTTCCTGCTGTACACAAACACCTGATACAGCGAATTGCCGGTGGTGTATGAGTTTACGTAGTGGGTGCCCACATCTTCCATAAATCGCACTGCGGAAGTTATATTTCCGATTTGCAGTTGATCCATTCTCGATCGCACATCCGGCTCCAAGGGTTGGTGCACCGGAATCTCAGCGTTAAGACGCCCCGTTTCCCTGAAGCGCACCACCCTCACCAAAACATACGAGTAATCGCCTTGGATGAAAGATGTATTGATGCCCAGCTTCTTGGCCGCATTATCCGGAAACCATCCGCCAGTAAATGCCTCCCACGGTTTGTCCATTCGCTCAATGGAAAAGTCACGGAAGTAGGCCTGGAACAGTTGCCTCCGATTCTCGCAGAACTCCATGTGAAAGTCTCCATGAAAGATTCCGGGCGTGGTGTCTTCATGACTCTCCGCCAGGCCACTCAGATTCTGAAAGAAAAAAATCATTAATTATCTAATTGTCTAGTCAGCTCAATTATCAGGTAATAAATATCAAGTGACATACTTGAATAATCGTATATAATGATCGTTTTCCTAAATCTGATCAAACAAATATAATAAGCGCTCATTCTAACGACAA ACGTGGCGGAAGTGAACAATATAATTACAACTAAAAATAGTTTTAAGTGATAACAACTTTAAACCCTATTTTAAAATTTTGATTATACTCCAAATAATTATGGTGATTGTGGTTAAAGGTTAATACAAACAATTCCGAGTTCATCAACGCCATTTAATTTATTAAATGTAAGCTTAACTCTGCCTTAAGTCCCTTACCCTATAGATGTTTTTGGTGGGCTCCTTAAACACCCAGCGATCCGGCTCCGAGTTGTCATTGAGCGGTATCACACGCATGGAGATTCCCAGGTAGCCATAGCGCAGGAATATATTGATGGCCTTGCCGATCCGGAGCTGGGACTCGCGACGACCTCCATCCGCCAGGAGCGCCAGGGTCAGCAGCCAGAAAAGGCCAGGCCACGACCGCATCGCTCAGCATTCAAGGTTAGATCTATAGAGGATTATAATAGAAATATTATATTGCAAATTTAAAGCGATTACACTTGAATTAGGCAAACGTTTCCATATTCCATATCCATATAATCCCTTGCTATAAAATATTATTGATTGAAACAAACGCAACCTATTCCGATCTCTTATAAAATTCGCAATTTAACAATAATGAGGCATATCTATCCCACAATAATTTATTCAAGTGACTAGATAACTCTTGATTGCAATGTGCATATTGATGACAAGCAAGTACAAACAGCGCTATACCATCCGAACTCATTACTCACTTAGACTAAAACCGGAAAGTTTTACAGCAAGCTACTTCGGTGGTTTGTTTATATTTTATAGCCAGTGCAGTAGTTGCGATACAGTGGGGTTAACTAAACAGCAATAATTGCAGGGCCGCCGTGTTTGTTTTCCACTCCATAAACGGGCGAT
 

Search Again