CR01905

CRIMIC CR01905

Gene CG12502

CG12502

Information

Donor Location Cytology FBti Stock number
pM37-p23L:865396..87170161D2Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band long band GCTTCAGCTATTCTCATCGCTGGCAT CTATTGCTCCTGTATAGCGGATTGGC

Images

Construct Design Sequences

sgRNA sequence TTCGGAAAGCGAAAAGCGGGCGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GATGCCACCTACCCTGGATG AGCGAGAAACAGCCAATCGT ATCTGAAATCTGAAATCCGCATC AACACGCCGAGACTCGATAC
 
Amplicon 5' Amplicon 3'
GATGCCACCTACCCTGGATGCCACCTCACCAGGATACCGCCTCCCCTTCTGCAAACAGCCGTTAGCACCGCACACAGAATGCATTGTGACCTTGCACGGGCAACAGGTGGGGCGATGGAAGTGGGAGTGCGAGTGCCATCTCCACTTTTCCTGTGTGGTTATGCATGAAGAATTCATAGGAGATTTAATAACTTGTGACTTGATTGTTCGATAATCGAGGAACATATATGTCTGAGAATCCCAAAAATCCTCCTTTCCAGCACCCAAATTGATGACAGCCGATTCGAGCCAAGGGAATTGATCAGCAGTCGCGATGCCCTCTCGTCGCGGTGGTGGTGGCACCACCAAGAGAAAGCACTCGCTGGGTAACCTGCGACGGGCTCATCCCGCCTCCGGAGCCACATGGAACGTCCAGGTGGTGCGGGGCAAGATGTCCTCGAAGTGCCTGTGGCACGCCTGTCGAGCCCTGATCCTGGGTCTCACTCTGATGCTCCTCGGCGCCGGCATGGCCACTTTGGGCTACTACGCGGATCACCTTTCGATGGGTTCCGAATTGCGTGGGAATGTCACGGTGCGGGTGAAGAACGACCTCAAGGGCTTCCATCTGAACAACTTCGCGTATGTGGGCCCCATTGTCATGGGTTTCGGAGGCTTCATTGTGGTGGCCTCCTGCGTGATGACCTTCGAGGCACGGGACTCCGCCGCTAAGGTCGTTCCAGCACGGTTGAGAGCTGGAGGAGGCGGCAGCAGCAAGAATCCCTCGCGGAGCAACCAAGGAAGCTCCGCGTCACAGCGTCGCGGGATGGGTAAGTTCTTAAAGTTCACACCATTAAATTTGGGTGAAAGAATAAAGTATTCATAAATATAATTTGATGGATGATCTGTAGGTGCCCAGTACCAGTCGAGTCGTTGGGATCAGCACTTCGGTGTGTTCCGCTCCTCGCCGGGCGATCCTCACCAGCAGCCGCAGACCGCCTGCATCTCCACCACACATCCGCATCAGCATTCGCATCCGCAGCAGCCATTCGATCGCGAGGCACTCACCGCCGAACTGGTCCAGTTCTCCAGGTCACTCAGGTACAGTTGTGGGCTATTTCGGGGAGATCACCTCATTGGGAACAGGACCCAAATTATATGTATATATCAAAATTCACTTATACGATTGGCTGTTTCTCGCT ATCTGAAATCTGAAATCCGCATCCGCATCCCGCTTCCGCCAACCATCAGTGCATCCAATCGCTTTTGTCCCCAGTGGCGCCGCCTTTCGGGGGCTGGTTCCGCTCCGGATTTGTCCGGATCCCATGCTCATGCTAATACCACCAACTCCACCAATGCCACAAACCACCAAAACCCAACCACCACAGTCACCACTAATTACTACAATTTGCTCTCACTGAATCGATTGTCGCCGTTGGATTGGGAACTGTATTGCTCGCACCGCCGTCACCGTCGTCACCATCACCGCCACTCGCACCACCACCACCACCACCACCACAAATCCTCAAGCAGCAGTGTGCGGCGGGTGCGCCCAGTGCGACCGGGCTTGGGAGCGGGATCGCAACCCTCCGGTGGAGGCGGAGGAGGAGGTGGAGGAGGAGCTGGCTCCTCTTCGTCGGCCCGGATCATCAGCAATTCCTCCAGCCTGATCCAGAGGGCCACCAGGGAGTGCTCCCTGCTCCAGCCACCAGCTGCTAGTCGTGTCTACTGGCAGGCCTCCTCCTTTGACGGCGGCAGTAATCATCCGCCCGGATTGGGCATGAGTTCCGGCGCAGAGAAGCGCAGTGAGCGGAACAAGCGGTCGGACACCGCCAAGCGGCACGTTCTCTCCCGGCAACGACCCATCGAGCAGGAGGAGGCACGGGATCACAGTCGCAGTCCGCTGGGACACAGGCGGTGAGTTCAAGGTGTCCAATAGCTCCTCTAGCTGGCTAATAACATATACCATTGCTTACAGGAACTCTACAATGTCGGACTCCTCGTATAGCGGCCGCTGGACGGCTCGCTGTGCCTCCATGGCCAGTCGAACATCCAGTATCGAGTCTCGGCGTGTT
 

Search Again