CR01888

CRIMIC CR01888

Gene CAH1

CG7820

Information

Donor Location Cytology FBti Stock number
pM37-p12L:13803626..1380999434D1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long band (weak) OK TCCCACCTATCGTCTGATTCAATCGC GAACATGTCGCCAGAGTTGACAATCG

Images

Construct Design Sequences

sgRNA sequence ACGAAAACCCGTAGCTGTCTGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TGCGAAACGATTTCTCACGC CTGGGAGAACTTGTTCCGG ACGGGTTTTCGTTTTTCCGC AGATCGCCGAGCTTAAGGTG
 
Amplicon 5' Amplicon 3'
TGCGAAACGATTTCTCACGCAAGGAAAATCATCAGATTGATATTATTTTTGGCCAGCTATATAGATACTGTATCACCTGACTTGCCAGTCCAGCTATTTTATATAGCAAATAAAATTTGATAATTTATGCATTTGTGCATATATTGAAAAATATCTGGACATGCAAGAAAAAACAGCTCAATTAATTTTCAGACGTGCCTAAACATTTCATTAGGCCACAATGCATTTCAGTTAGCTAAACTTTTACGGCCATTCGAGTATTTCATTTGCGCTTTATTGTCACCATTTCCCACCACATGCAAACAAATAATTATTGGCGAAAATTTTAGCAGATGATTGAAGGGTTGCATGGTTTGGATTGGTGGTCGATAGCCAAATGTCGTGGCAGTCCAAGGGTAGAGACCATTTCTGGGGCTTCTTCAAGCCAAGCTGGGTGATAAATATAGCAGGGGTAGTTGCCTTTCAGCCCGGTCAATTGAGTGGCCATAAAAAACAGTATAACCCAGAGACAAGTGGCCCCCCTCCCCACGAACAGCAGTTATACAATATATCATCCGGTACTGACTCAGAACTCGGAACTTGGAATTCCGGGGTGCGGCTGGGGGCACTTTCCCCAAACGAGTTTTTTGTCCGTACTTCCTTGCGATCGCCGCCAGGAAAGTGGGGAAAAAACACGCGAGAAACTCATGCCTCCATCCAATTGGGATGATATTATCATGCAAGGCTCGCTTAGAAGCGCTCGGCTCGTAAATTCGTAAATGCTAATTGCCACATTTTATTTTGTCGTGTTTTTAAGCGTTTTTCTTCTTTTTTTTTGCACTGTCGTAACGAGAATTTCTTAATTTGTCTCTCCGGTTTTACATGCGCTTTTTATATTTTTAATTTTTTTTTTTATATTTCAAATTGCTGCTTTGTGTATTTAAATGTTCGGAGAAATCGAAATCACTATACTCAGGGGCAATTTTCGATGGATTTCGTAAGAACGATCATTATACATTATAGATTCTATATAGAGATCAAGATCTTAACGTTTCCGGAACAAGTTCTCCCAG ACGGGTTTTCGTTTTTCCGCCGGCGAATATACGCTATAAATGGATGTGGGTAATTCATTTGCAGTAATTCAATTAAAAAATCATTCGGATTTTATGGCAGCATTAATGGTCACAATTGTTTCAAAGCTTCGCTTTTGTTCCATGTCATCCGAATTGAAACGAAATTAAGTGCAAAACGATGATGAATTGTTTAATATACATATAACTTTGCAGTTAGTAAACGCGTATAACAAAGGCTCGTTTGATCAGCTTTAAGGGACCCATAATGTCAACCGGTTATATCCGATCGAGTTTTGTTTGAACAAGTGCGGCATTTCCTTGTTTTCGTTTACTTTCTTCTACTTTTTTTTTATTAAAGTCTGCCAATTGTTATCACAGGCACTGTGAAATGCCGCCAGGTGATCTTAAAGTATTTACAGCCAAAGTCGGCAGCAAACTCGCTGGGTAAATAAAGCCAGTAAGTAAGCCTATACATTTAAATGAGTCGCACTATATTTATTTCTACATATACATATATACAGTACCGACTTCGGAGATATCTTAATAACTCGATTGTTGATTATAAAAAGGTAATGTGCTAAATGCGGCAGTAAATTCGCACTTGGCTGCTAACTCACAAAAGGATCGTGCAACTCCAATTGCCTGCTTCTTTGTATGCTGCCCCACACGGCGTATACGTGACATTCATACGCCATGTGCTGCGTCAGTCACATGCACACACTTTTTGCACCCGAATGGTGAATAAGGCTCTTGATTTCAACTTTGATAAATGATAAATGCATTTCACCTGACTTTTGTTATTTACTATCAGCATTATGAAGGACTTTGAGAATCGGCGAAATAAATATAGGAAGCTACAAAGCTGTTGACACCTTAAGCTCGGCGATCT
 

Search Again