CR01879

CRIMIC CR01879

Gene Ank

CG1651

Information

Donor Location Cytology FBti Stock number
pM37-p04:129849..115074102A3Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GAGAAACACCACTTCACTTGGCAGCT AATCTTCTAGCACAAGCACGCACACG

Images

Construct Design Sequences

sgRNA sequence ACAGCGAAACGAAATACTACGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CGAGCGGGGAGAGATCAATT CTGTTGCTACCGCTCTCACT TAGCTTTTCGGCGATCACCA TGGATGCTATTGCCCGTGAA
 
Amplicon 5' Amplicon 3'
CGAGCGGGGAGAGATCAATTTCGGACGTCACCAAAAAAGGGTCTGAATAGTGCAAAACCAATGTATGGCCGTTATGCGTCTTATTATTCTAATGTCTGCTATTAATTAGTGCTTTAAGTACTAAATTTTTATCAGTGCCGTGTTAGATAAGGAAAATTTACCTTTCTTATTTAGTACTGAAACATCAGTAAGATCGTGGTCGGTGTTTGTAGTATCGAAGTTCTTCTGATCCTGGCCGTAGTTGGCTTTTAAATCATCAGTTGCCATGTATTTGTAATGGTTATGATCCAAAAGATCATCACAAGATTCGTCATCGGAATCGGAAAGTAAGGTTTCTTGCATAAGCTCTGGAGTCATTACCTTGAGTTTTTCTTCAATCGCACCAATATTTGAATTAATAACGGATGTTGAAGTGACAATTTTGAGGGATTCCATTACAGTTACGTATCCAAGGTTACTTGCAATGTGGAGAGCTGTGTTCCCGTCCTAAATTAAGGATTTGTATTGAATTTGTAATGAAAAAGCACGATAATATACAATATATTTATATGGATATGACACAATCTATATAAACAAAACAAAGTTGTTGACTAATATAAGGACTCTAACGACTCGACTTCCTGGCGTCCGATTTGTATGGCTTTTTTTCTTTTAGATTCGTAAGGAAAATTTTTTCTCTTTTCTGGATTCGTGTTATATTTGTGTTTATTATTGGTTGTTTCGCTGACTCGTTCATTGAATCGTTCACCTTTAAAATGCTAAGTAAACAATCATTAATAATCATCTCACGTTTTCTTTGCAAAAAAGCATGCAAGGCGATTTCATTCTGAAGTGAAACAAGTGAAACAAACAAACGACGGTCAGAGCATAGCACTTTCTTTTTCGTTCTGCAGCTATGGCTCTAAAGCTTTCTTCACAGTGAGAGCGGTAGCAACAG TAGCTTTTCGGCGATCACCACAAAACTATTAATTATGACCATTATTTTTGACCATTTTTTAGAACAGGCTTGGAAATGTTAAAAAAAAAGTTCCAAATATTACAATAGCTTTAATAATAATTCTATATGACTTTCTTAGGATGAAATAAAATAAAATAAAATACTTACTTTTGTTAAAGCATTTGGATTCGCTTTATGGCGTAATAAAAGATTAATAATCATAATGTGACCTTGCTGAGCGGCTTGATGAAGCGGGGTATACCCGATATTAGAAGACATCTCAATGTCAGCGTCGTTCTCAATAAAAAACTTGACAAGATCGAGGTGACCATAATGGGCAGCCATATGAAGGGGAGTATAACCATTCCTAGTGCGCTCTGAAATGTTAGCACCGTGCTCCAGTAAAATCTGTGATACAAGAACATGGCCCTCCTGGGCAGCCACATGTAATGGTGTTAGGCCATTTTTTGCAGCGGCGCTAATAACTCCATACTCTAGAAGTAGTTGGACCATATCAACGTTTCCCCCTTGAGCCGCCAAATGTAACGGAGAGAAGCCACTCTTGCTAATAATATTAACGTCTGCACCGTGTTGCAACAGCTGCATCGCAATTTCCAGATAATTTTTTTTGCAAGCTATGTGAATAGCACATTGACCATTTCGGGCACATAAATTTGGCGATGACCCATTTTTTAAAAGGAGTTCTACTATTGAGGGATTATTGTAGTGCGTGGCCACGTGTAATGGGGTCACATCATTTTTCCCCTGAAAATCAATAGAAGCTCCATTTTGTAGTAATATTTGAACCACATTCTGCTTTCCGTATTTGCAAGCTAAATGCAGTGGAGTAAACCCTTTTTTGGTAACAGCATTATTTTCCGCACCATTTTCCAGTAACACTTGGACTATATTCTCTTGTCCTTCTTTTGCAGCAATATGCAGCGCCGAATATTTGTCATTAGATTGAGCATTTATCTCTGCTCCATGCTGCAGTAATAACATAATTATATTAATATTTCCTAATCGAGAAGCTACATGAAGTGGCGTTTGGCCTTCACGGGCAATAGCATCCA
 

Search Again