CR01875

CRIMIC CR01875

Gene CG5262

CG5262

Information

Donor Location Cytology FBti Stock number
pM37-p03L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse

Images

Construct Design Sequences

sgRNA sequence CAACGCAAAAATTGTGCAAGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GAGTGGTGGCACATGAAGGA TTTTGCGTTGTGTGCACTTA AGTGGGCGTTATGGAGTAGA CCAGACCCTGCAAGTGCTAA
 
Amplicon 5' Amplicon 3'
GAGTGGTGGCACATGAAGGAGTAAACACAGGCGCCGAAAAGAGAGGGAATTCCATATACATTAAAGGTCGCTGGATGACCTTTGGCACCTCTGGAAATCAAAAGTTTTAGCGATATGCAGATCATCAGGGTAAAAGCTGAAATACCACGTTTTAATATCTTATTAGTTGCACAAAATTCGAAGCTTACCCATCCACCGAAAAGCAGCGGTCAGCATCTGCAGGTACTTCGTTTTCTGCACATTAAAGTACACAAATGGACCAAAGATCAATGTGAATCCTATGAGCAACACCCTGTACATGTTCAAGCGAGATATCGTGTGTTCCTTCCAGCAGGCCAGAGATGTATTGTTCTCAAAGTCTCCGGGCCAATACATCAAGTTATTAGTATCCGTTCCATTTGTTTGGTCACTGAAACAAGACGATGAATTAAATTACATTCTCAAACGTATGAGAGAAAGGTTTTCATAACTCGGAAAACAGTTTCCAAATTAGTTTTTGATCCGATGTAAGCTGCGTGCGGTTCTGAGTACTTACCATACGACGTCACGCAGACTTCTTGCCACGGCGGCGGAATATATGCTCAGATCCCCGTAAAGATAAACAATCAGGCAGAGATAGAACATTACGCGGCCAAACTCATTAAAGAATAGTGTCGCCATTTCGCCAAGTTCGAATTTGTGGGACAGCTGATAGTAGTGGAACTCCCGGTTTTGGATGGTCAGCGGAACCCGCTCGAAATCGCCAACTTGCTCGGCTCCCGATGCCAGCGAAACATCATCAGCATTATCATCGTTTTCACTGTTTTCGGCGGAACTGCGACTTTGGCGCAGGGCCTGCAGAGTCTGCCAATTCCTGATTGCATTCGCACAAGCCATTGCTTCTATGATAAAAGTGACCGTCATGTAACTGATGATGGCCAGCAGAACAATGACGATCAGGGAAAGCATCCATCCTGCCCTGGCAAAGACTCCGGGTAGCGTCAGCGCTCCGGTTCCAACGATTAGATTGAAAATGAATATGAAGCCAACCTGTGGATAGAAAAGGAAATTTTAACTCACGGAGCGACAGGTGTTCAGATTGTGGAACGAAAATAAGTGCACACAACGCAAAA AGTGGGCGTTATGGAGTAGATTCTTATATTTCCACTGGCACACCTATATGTACTTAAGGCGTTTTATACAAAAATATAAGCACAAATCTTTCTGACTTTTGTAAAAATGCACATTTGTTGCGCAAACAGCATAACAAACATGCAACAAATGCATACAATCCTTTGTTTTGGTGAAAGGAGTCGCTGGCTCCACACATTGAAGTTCAACTTACCAGATTCGAGTACGTGGGCGCGGCTTCGCGGCCATTGACAAGGCGAGGCATCTTTACGCTGGTTCTTTGTCTTTTCACCAGGCTTCTATCCAATCCGATTCAATCAAACTCTTAACAAAAAGAAAACAATAATAGAACAGATAGTGCACTCAATGCAGTGTGCCCAACTGTTTTGACGAAATAGAGTATACACACAATTTCCTAACGCCACAGAATTAATTATTTAAACACCCAATTGGCGCGTAATTTTAAAAGTATGTTTGTACACCACAGGAGACGAATTACTTCATTTAAAGCTAAAAACAATTCGATTTTATTTCAAAACAGTAAATTTGTCGTCTAATATATACATTGCACAACATGCGCGTGTGTAGCGAATAAAAGGCTAAACTAAAGCTATCCATGATCGACTAGGAAAGGCTTAGAAATTTTACTGCTTCTTGGGAACTTCAGTGTCGTTTTGCCTCTTCTTGCGATTCTCCAATATACTTGTGATGAAGAACTCGCCGGCTTTGTAGGAGCTGCGCACCAGCGGTCCACTGGCTGTGTACAGGAAACCCAGTTCGTTGCCGCGCTCTTCCCAGTGCTTGAACTTCTCGGGCGTGACGTATTCGATGACCTTGAGGTGCTTATTCGTGGGCTGCATGTACTGACCCAGGGTCACGCAATCTACGCCGGCCTCCCGCAGATCCTTCAAGGTGTTCTCGATCTCCTCGTCGGTCTCGCCAAGTCCCAGCATAATTGAACTCTTGGTGATGAGATTGGGGTTGAATCTCTTCGCTTCGGTTAGCACTTGCAGGGTCTGG
 

Search Again