CR01863

CRIMIC CR01863

Gene CG12974

CG12974

Information

Donor Location Cytology FBti Stock number
pM37-p13L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK

Images

Construct Design Sequences

sgRNA sequence CATTACGGGCAAGTGCTGTCAGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GCGGCATTGTTATACGCCTG AGCACTTGCCCGTAATGGA ACAGGGCGCTAAACATGTGA CATCTGGATGGGCTTGACCA
 
Amplicon 5' Amplicon 3'
GCGGCATTGTTATACGCCTGGACCTCCACCCTGTCCATACAAATCGAGAATTATTTTCAAGACATTAAGGATGTGTGAATCGTTATACTTACTCCTCGTAGGCGCGAATCGGGGTCCTGGTGGTCAGAATATCATTGGAATCCTTGCGAGGATTGAACAAAGTATCCTGTGGAAAAGGGCATGTTTGTTTGATTTTAGGCAAGATAGCTATAGCTCATTCAAGATTTTGTAATTAATTTATATTAAGGAAGATATTTGAGGCTTTTTAAGGATACTTTAAGTGTACACTGAGTTAAGAACACCTCAGTTCAAGCGAACTGTCCTTGCAAAGAACCCCCGCACCTAAGGCCCAGTAAGTCGTCATTTTCCAGCGTGCTCGGTCAAACCAAACCGAAAAGCCAAGAGCCCGCTATCAGGCAAACCTGGTGCCAAATTGGAAACCAGCTTATCAGCAATTACCACCACCACATTGAGTTAATGGCGACAAAGTGCTAAGTTTAGCCATGTCGTAGTCGCTGCCCGGCGATTTTTAACTTCTACGTTGTTGGAATATTTTCAAAGGCAGTGTCGAAAATTTATGGAATCAGCGGAGACAACGAAGAAGTCACTCAGCATTGGTGGGCGATGAGCTCACTCGCCGACCTGACCACAACTTACCACATTGTCCTTATCGGTGGAAATTCGAATGGCTCTCGCGACAAGGTATGCGAGCAGTCCAAAGTTAATGAACCACAGAACGAATCCCTTGAAGGAGATGACCATCATGGAAATGGCAGCCACTCCTCCGGCGATCAAGGTGGCAGCCAAGGGATAGATGACACCAGCATTGATACTATTGGCATTATACCTCAGAGCCTCCTTGTGGAAACGTCCGTAGTCCACGCCGAAGATCACTCCAGAAGCTACATCCATGCAGCATATGGTGGCCACGAAGAAGGCCCAGATGTAGATGGCAGTCACGGTCTGCTTCGGGTTGTCCTTGCGCACCCCTGAAATGGTAAGAGTATAAGCGGGTTATTAACTTAAGTGTAATCCATTACGGGCAAGTGCT ACAGGGCGCTAAACATGTGATACTTAAATGGGCTTACTTATTGGCGATACATCAATCAATCTTATAATGGAGTCATTAGGTAATATAATTTTAAAGACCATTATGTACGAGTAAAGTATGCTCTAAAATGTGTCAAAAAGCTAATCACTTTGGTTTCAAAATTAAAGTAAATAGCACTTAACAAATTTTAATTAATCAATTACTAGATAAGATATGTTTCGTACATATTTGAGCAGTATTAAGATTGAGTCATAACTATAACTATAACCATGCTACTATATTTTAACTTTAGAAAACGAATTGTATGAATGAATATATCTGTCTATAACAAAGAATAAGACTTTCCAGTTTACTTGTGGGCTAATGTGCTTAATTCTTTGAAAGCCAATAGCAAATGCTGAAAATTGTATATGGTGGGAAAGAACCATTAATGAAATCGTTATATAACCCATCATATAAGTTCCCAGCGAACTTATCATCAAGTTTTGTTTATTTGGGCTTTACGGCTGTGTGCCATGCGTAAGTTTTGGATGCCTCACAAATAAATTTCTAGATTTCTCCTCGTGAATCATAAAGGCTTCGATATCTTAACTATGTATGCAGTTCATTTCCGGTTCTTAAAGTACTTACACAGTAGCAGCACAACGGAGACGATTAGCCAGCAAACCGAAACGCCCAGGTAGACCGAATTCCAGATCAAAATCTGGGTGGGATCAAAAACAGTAGTCACTGTATTCAGGATGGTTTGGTCGTAGTTCTGGTAATCACTGGGATTCATCTTGCAACTGCCCTTGAAGTACACGTCAAAGAATACAGTCTTGACCATGGAGCCATAGGTGAGGTCATTTGTAATATACAGGACACAATTGTAGGCACATATCGCTGTTATGGTCAAGCCCATCCAGATG
 

Search Again