CR01859

CRIMIC CR01859

Gene CG13532

CG13532

Information

Donor Location Cytology FBti Stock number
pM37-p12R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK short band

Images

Construct Design Sequences

sgRNA sequence GTCTTTCGGCTCCTGTCCGCCGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CCGCCTGCAAATAATCGGTG GACAGGAGCCGAAAGACAA ACCCTTCGTCCAATCTGCTC AGGCGGTTGGTTTAATGCAC
 
Amplicon 5' Amplicon 3'
CCGCCTGCAAATAATCGGTGGGTGTCACGACCACGGCCAAAAGAAAAAGGATCGGCGGTGAAAGATGTGCGGTGGCGATGGGAATGGGAATGGGTAGCAGGTGGTGGTGGGGGTCGAAAGGTCTAAGGTGGTGGTTCTGCCTCTGGTTCTGCCGGGTAACCTGCACCCGCCCCCATCTTGACTTGGCCCCCGCCACCAGGGTGTTTGCATAGGTGTTCTCGTGTCGGTGTTTACACAGGGAGACAAAAATTATGATTTATGTACTTAAAAGCCATTAACAAAAGCCGAGAAAGCCTTACTCTAATGCGCTGGCCTTTATTCTGTCCCACTATTAGCATTCATTCTCTCGCATATCATCTTGTGCCTGGGCAATTCTAATTTAAATTTTCAACGTACCTTTTTAAGGAACTTATATTCTATTATATTTCATGATATTACTTTCTATTTTGTTTTAAAGCAACTTTGTTAGCTATATATATATATATCCATAACTACGGTTTGAATATTTTAATCTTAGTTAGTATCTGAAGTTGTTTTCAGTGCTGTAGGACAACTGTAATTGGCTTAGTCAGGGCGTTCCCAATCGAGTTCCCCTTTTAAATGCTAGGGTCAGTACTTTTTTTTGCTAGTGCAGGTGCTGGGCGCCGTCTGTGTGGCACGTGTGATTCGCTTTCATATTTGCATGCGTGTCATGTGGCAGTCTCTGCGGTGTCCGGAACCACGGCTTGTTTGTGCTGTTTTGTGCTTTTCTTTGGGACACTGTTTTGCTTGGTATTGTTTTGTTTCGTTGTTTAGTTTGACACTTGATTAATTCTCACGACTTTTTGTCTTTCGGCTCCTGTC ACCCTTCGTCCAATCTGCTCCAATTGCGACAGTTCCTGAATCGGATTTCATGCTGGAAGCGCGGATGAGCGGTTCGCGTATGGACGTGGACATCATGTGTGCGGTCCAGCACGTCTTCCCGCAACCCATGCTGTCTGTCATGTAAGAGGATCCACTGTCCCCGGCAATTTAAGGCCGGTGAAATCCAATAGCGCAAGGACCTAATCGTTCCCTCCGCAGGTTTGACACCCACATACTGGACTCGGTACTGACGCAGTTGGACCAGGACCCCAGTGGCCTCTACAGCATGACCGTTCGCACCCGCATTCCTAGAGATCAACTCGAGTCCCCCACCCCAATCACCTGTGCGTTTATCCTAGTTGGCACCAACTACACCAAGCGCCGGGAGACTATTTTCTATGGTAAGTACAGGTAAGCCTGGATAACACTTTGCTTATAAGGACAAGTTATTCATTCATGCATCATAGCATTAAAGTAGTAAGCTAGATTTGTTTGAAATTTTTAACATCTGTCCGTTTCTCCATCCTTATAGAAAACCTAGTTTTAAAGTTAACAAAATTGAATACATAATCTAATATTTTCTTCTTTACAGATAAGGCCTCAACTATACAACGCAAGTGGACAACGGTCGCCGTAGTCATGTCCATCGCATCCTTAGCTCTAAGCAGTTAGTTTGGTAGTGTCCTTTTTATGTAGGCTACATTCGTTTTTATGTTTGGACTAGGAACTTTGATACTCCTTAATTTTTAATAGACTTTTAACGGATAAACGTAATTTTTTGCGGTATTTTTAAAAAAAAGCGCTTATTTTGTACATGCATGTATTTGTAAGGATAACGAAACACAAAACAAAAACAAACACCACAATGCGTAAGCAAACGAACCCATAAAGACAAAAAGGACAACAGTAAAGCATAACAAGAAATTCTTGTATTCATATATTTACCACATAAATAAAATATATATGATAGTTATATACGATGTATAGGTCTAATTGAGTACAGAAACGCTAATAAAAAAAATACGAAAAGAAACATTAAAAGTGCATTAAACCAACCGCCT
 

Search Again