CR01855

CRIMIC CR01855

Gene CG10479

CG10479

Information

Donor Location Cytology FBti Stock number
pM37-p03L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band OK

Images

Construct Design Sequences

sgRNA sequence AGCGGAGTTTGGTTGGATCAGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
AACACGTCCCGCACACATAT CCAAACTCCGCTGGCTACAA GGAACATGGGGCTAGGAGC GGGGAAATCGGGCTGAAAGC
 
Amplicon 5' Amplicon 3'
AACACGTCCCGCACACATATCTCCCCCAACTCCCCCCATCATCTATGAACGAACAAATTCGGTTTTTCAGTGAGTTGGTTTTTCATTTAGTTGGTTAAACGAGTTCGTTTTTGGGACTCGTAAAATGATTTTCTCACTAATTTAGTTTAGTATGCCAGGAAAAATGTTTATAGTTTCAGCTTTTTGGTATGTTTTGTAAATTTTTTATTACAATTATCTTTGCCTTTGGCTGGAAAATCCTTTGCTTAGACACATGTGGCGTGTGGCATTGGCTTTTTTATGGGCCTCCCTTTGTATCTTTTTTTCTGTGGCATTTTTATAGGTGTAAAAAATTGGGTCATATAAAAATTTATTGAAATGTGAATCGAATTAAGCTGTTTCTTTTCAGCCGTTTGTTTTATGCGTGTTTAAAAACCATTTTGATGGGTTTATTAAATGCAAATGAAAATTGTTGAAATTTTAATTGCGTTTTATGGGCACATCGCTTTGGGGCTGCTTCTCTGCTGCGTGGGTTTTTCAAGAGATGAATCTCATGTTCTTTATATTTTTTGAAGAGCATAGGCAGGCAATGAACTCTTGGACTTTATCACTTTGAGAGATGGTGAACAATTTAATTAGAGACTCTGACAACTTTTTCTACAACTCCAATACGTCGGCTCTTGTGTGTGTGGAAAGTCTAGTAACTGGGCTTGCAAATAGTTTTCCCCGAGTCTAGTCGTCTAATGCACACAAATCCTTGGTGGGAAGCCATATGAAACTCAAACACGGACAACGGACTGGTGATAACGATGATGTTGGCTAGCTACTCGGTACTCGGTACTCAGTACTCCGTTCTCTGTTGCCGGCTGATGGCCAGACTAAGCCAAAACCAAAAACTATTTGTAGCCAGCGGAGTTTGG GGAACATGGGGCTAGGAGCTGAAAAAGAAGAGGTATTGAGTTGGGTTGGGCGGTTCGGATACCGTTGAAAGCTTTTTTGCATATTTGCATTACATTTTCATGGCGTGGCATGTGGCGAGCAAAACGAAGAGAAGCGAAAATTTATATTGAGTCGAGCGTAAAAATAACAATGCAGACAGTTGATGGTCGAGGCGGCAGACGGCATGAAAATAAGTGAAATTGTTGTTTACTCAAAGCGACGGGACCATTCGGTAGTTGGGCAAAATATGGAGCATAAATTACAATGCATGCAAGTCGAATGCAGTCGCCGGCTATTTAATTATGCTCATCAATTTGCGCAGCCTGCAGATTGCAGTTTCCCCAATAAATCTTGGGGCATTGTGAACAAGGCGTCTGCTTCGAAATTCCTAATTAAATGCACTTAAAAGCGATGCAATTAATTTTCTATCCTTAGCATTTCCTCTCCAGGGGCCCCCGAAAAATCAAAGAGTCTGCATGTAAATACATATGTAGAACACGAGCATCCAAATAAACATTAATCACTGCCCTTGAAAGGCAGTCCAGAGGCGAGTTCTTCGGGAAAAGTGCATTAAAATGCCTTAGAATTTAAATGCCTCAGCTCATTGCTGCTAATCGTCGCCAGCAGTTGATTTAATTTTAGCTGCATCTCATCGAGAATTATGAGGCCCATCACGGGATCTCGGCAGTCGAGGAAATCCACTTAGGCAGGGCGTTGAAGGCACCAGAGCATGGCATCATAAGCCACACGAGGAGGAAAATGCTTTCAGCCCGATTTCCCC
 

Search Again