CR01847

CRIMIC CR01847

Gene TrpRS-m

CG7441

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 long band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TTTAAGTCTGATAAGCAACTAGG

Amplicon 5' Amplicon 3'
GCGAACGCTCAGTGTCAAAATTTCGGCCGTTTCGAACAAATAATTTATTTTTGGGCTTTGTTCACACATTTAGCACCGCATTATTCCCAATATTTTTTACTCAAAAGTTTTGGGGTACAAAATTCATAGCTCATTGCAATGTTCCGATTTGGCAAGCTCCATCGCAGTCTGTCTAAGGTGGCCAAAAAGGGACAGACAGCTGTGTATTCCCAGCGCCGTTGCATTCAGGCGAGGAGTTTCTTGCCGGGATTGGCTAGTAGGACGGCTGGAACGCCCTCTGCGACGGCCCAGGTAACCGGTGGAAACAAGCAGCACGTACACCCCCATGGTAATTCCGTTAACAGTGGCCACGAAGAAGTAAGTGCATTCGTAGAAATAGTTTACATAACACAAGACTCTAATATATTACCCCAACCCAGCATAACACCCGCTGGCCGAGGAAAGTCTTTAGTGGCATCCAGCCGACGGGTTCCCTGCATCTGGGTAATTATCTCGGCGCCGTGCGCAAATGGGTGCAGCTGCAGAATGCTCGTGACGATGTCACCGTGTGTATTGTGGATTTGCACTCTATTACCATGCCCCACAATCCGCCGCTTCTGCGAGAGAACATCTTCACCATGGCCGCCACGTTGTTGGCATGTGGCATCGATCCCACCAAGAGCACCCTCTTTGTCCAGTCCGCCGTTGCCGAGCACGCCGAGTTCAATTGGATCCTTAGCTCCTTGACCACCATGCCGCGATTGGCTCAACTGCCGCAGTTCCGAGAGAAGTCCCGTCTTCTAAAGGATGTCCCTCTGGGATTGTACGTTTACCCGGTTCTCCAAGCAGCCGACATTATGCTTTACAAGTAAGTAAATATATTCCGTTTTTTGTTCAGAATGTAAGCCGGGAATGCAAGA AGACTTAAATGCTTTGGTTCAGCTTTACATATTTTTAAACCACCCTTTAATATCTGAAATGGTTTGCCATTTGCTTACTTATTATAGTACTTATAATATTCATATTCGTTTTTCGATCAGGTCCACTCATGTTCCTGTGGGCGCTGACCAGATTCAGCACATTCAGCTGGCCCAGCACTTGGCCAGAATTTATAACGGTCGCTATGGCGAGACTTTCCCTGTTTGCACCGCCATCATTGAGGATGGTGATGCCTCCCGTGTGCTGTCCCTGCGAGATCCCTCCAAAAAGATGTCTAAATCGGAAGCGAATCCCAAGGCCACCATCAACTTGTGTGACTCGCCCGACTTGATTACGCAGAAGATAAAGAAAGCCGTCACAGACTTTACATCGGACATTACTTATAATCCTGGCAAGCGTGCTGGCGTCAGCAATCTGGTCAACATCCATGCCCAGGTCACGGGACAGAGCATTAAGACAGTGGTGAACGAGGCCGCCACTTTGGACACGGCAAAGTATAAGGACCGTGTGGCGGAGGCTGTGGTCGAGCACTTGCGTCCGATCCGAGAACAGATACACCATCACATGACTAAGCGCAACGAGATGATCTACTTGCTGGAAGTGGGTGCAGAAAAGGCACGTCAGCAGGCACGCCAAACGTTGAACGATGTTAAACAGCGCCTAGGACTAGGAACCAGTGCCAACATTCCGGCTGCGGTGCATGTGGCTCCACTTCTGCCCGCACCCGATATTTCCAAAACCTCAGCAAGCAGGCGAATGTCCAAGGACTTCGACGGGAATGTCCACGAGCGTCACGAACGGATGTACGGATTCGGAGATCAGCCAAGCGGAGGAGCTGGTCAGTCAGCCACCGGCGAGGTGGCGGATATGCCTCAGGCCGTTGTACCGCGGGTGATCCGTCGGGCGCCCATCGTTCCCACTCAGTCTATGCGCGTAGAGAAACAACTAGGTAGCACTCGAACTCGGCACGTATTCCAGATGGACACCTGCAATGCTCCGCATATAGGGTTCAAACCGCCGCCAGGATTTTCGGCCAGCATGGTCACCGGTGCTCTAGCCAAGAACAAGCGCGCTACAGTTAAACCCGTTACTGGCAACCTGGGCTTCGGCCAGCAATCGCAGGGTGGCTCTTACAAGCA


Search Again