CR01842

CRIMIC CR01842

Gene CG7945

CG7945

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GAGAGTTGTGTGGGCGTTCGCGG

Amplicon 5' Amplicon 3'
TCGAACTTCTTGTCGACCGGCCCAACATCGGCCTCGGGCACGGTGTCCATGTGTCCGGATGGATCCATTGAGCTGCTGCAGCAGGCGTTTAAGTAAAACTGGCATCGTTGGCGTCCGATCACGGGATCACCCATCTTGATCATGCTGTCAATCAATACATTTATCTGGCTAAGGGAATCCTCCTGAGAGTTGTCCCGAACAGTGCGCACACGCAGCTCCACGGTGGCCAAGCGAGAGCTCACCCGTTGTAGGTACAAAATGATCTCCTCTCGTTCAGCTGCAAAAGAAGGTGGTACAACATTAGCTCACAGTCAACTATGAATAACCCTTTACTTAGTTTGTCATCAGAAACCATTACTTCCGACTTCGAAATAATACACATTTTAGTAAAGCTATGAACAATGAGGGTTCAAATTAGTTTTAAGAATCACTGTCACTTACCTTCGCTCATGTTCTGCATCATTTCGTTGCTCTTGATCAGATCCATGGACATCAGAAGGTAGTCTTTCTTCTCCTGCAGGTTGAGTGCATCCTTGCGCAGCTTCTCCACACGTGCATCCAAACTATCCAGTATGGTGACAAATCTGCGAGTCACTCAAAGGTTAGTCACGCTCAGTGGTTATTATAAATTCAAGATTTACCTCTCGCTGGCGTTAAATGGTCTGTCACATGTCGGTTAAGTGTGATTGCGGTTCAGTGGTTAAGTCATGAAACGAGACAAGCAACGTTAGATTGTTAGATCGCTCTGCTACAGATCGACTGACCACTTATAGAGCTACGAAATTATAACCAGAATATGTCTACAAGAAAAGGCGCTCGCACACAAAGCTCTTTTGAGAGTTGTGTGGGCGT TCGCGGCAGATACTTTAAGCTATCACCATTACTATTATGGAACAAAAGATTCGAATGAAGCTGGTAGCTGGTAGTGTGAAGAAATAATAGATAAGAAACGTATAACTTTTGTTTCGCTACGAGGTTGTGTGAATATAATCGGTGGTATTGTTTTGGTTTCGTGTCTGATTTGGTTTTAGTTATGATGGAATAACAACCTGTCCAGAGCTCTACTATCGTCGACGAGTCCGTAGGAGCTGTTCCCGCCATTGCCACCACCTCCGGATCCGGATGGGGATGAGGAGGCCATGGCATCGGCCCTCAGGTCTTGCAAATGATCAAAATTCATGGATGCCTCCGAGTGGTAATCGCTGGGCGAGATCTGATGCAGCTGCTGGTGATAAGTACTATGGTGATGATGATGAGTGTCACTGGTTTCCTGCGTTGTTGGCGCATCAACTTCCATATCCTGCGGCTGCTCCAGATTTGATTTAAACCTGTCGCCCTCCAAAAAGCCGGTCAAGTGTTTGTCACCCAAGATGGTTGGATAGCTGCCTACTGTTTCGTTTTGGGTTTTGGTTTTATCTTATTTATTTTTTTTTAGCCGCTTTGCTGGCTACTTTTTTTGGAATGTCTTAAGCTTTTTTTTTCGAGTGGGTGTCGAAGTGTTTGATGCTGTTGCTTAAGCTTAATTTTATCTGTTTTTGCTTTGAAGCTGCAATAAGAGAGAAGAGGAAGCGTGAATGCGCAGAATTCAATTACCTATCTGAATGTGGGCTGTGAAAAGAGCCTTCGGTCCAGGAGGCGTCAAAGCCATCATTGGACTCGGGCGTATCGGCTTCTATATCTTCCGGATATCGGTTTATTATCTCCGCCTCCTGGGCGGGTTGCGGCGGCGGTGGCGGCGGTGTTGTGTCCGACTCGCAGCGACGCCGTTTCCGAAAAATACCTCGAAAATTCTCAAACATTCTCGGCTGAAATCACCAATTTTCTAGAAGATTACGCCTAATTCTTCTTCTTTTCTTGTGGCAACCGATGTCTAGGAGAATCCCCGGGTGGCTGTTTTGAACTTGAATAAATTACCTGCCGCCCGAGACTTGAGGCTCCGGTTTTAATGCACCTTTGGCCCGAT


Search Again