CR01833

CRIMIC CR01833

Gene CG12004

CG12004

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CAGATTTACTGGTTTACAGTTGG

Amplicon 5' Amplicon 3'
TCGGAGCAATGTTCGTGTGAAAGTCGAGACGAGAACGTAAACATTTTGCCTGCCTAGCTGTCTGTGCTGAGCACTTCAACTGGCCGCACAATAGCTCCTGAACCTAGCCCAGTTACACCCACGCTAATCGGTCTTCCTCGTTCTGGATTCCATTGCAGCATGAGCACAACCGCCGCCAGTCTCATCGAGGCGGCTCTAAATGCCAGTAGTGGAAACGCCACGGCTACAACTGCGGGATCGCTTGAGGCTACAGGGAAGCCCAACTACGTGGTGCAGGTAAAGAACACTCCGATGAGCACGCCGCTGGACCCGCTGCTCCACGTGGGCGATGGCATCTTCCTGCAGACAAAGACCGCCCAGGTTCTAGCTGGGGTGTGCGTCTGGGCCGCCCTCTTCATCACATGTCAACAGGTGAGTTAAGGCGTCATTGGTCTGAGTTGTGTACTAATGGATATCTTTGGCAGATCTACCAGCACCTGCGCTGGTACACGAATCCACAGGAGCAGCGCTGGATCGTGCGCATTTTGTTCATTGTGCCCATCTATGCCACATACTCCTGGATCAGTCTGCTTTTCTTCAACTCGGATAACGTTTACATCTACTTCTTTACGGTGCGCGACTGCTACGAAGGTTCGGCTGATTTGATTTTGAATGATTTTTGCCCATCGACTAATTGCTAACCCCATTTCCATCCAGCCTTTGTCATCTACAACTTCTTGTCGCTGTGCTATGAGTACCTGGGTGGCGAGGGCAATATTATGTCGGAGATTCGCGGCAAGCCCATCAAGACATCGTGCCTGTATGGCACCTGCTGTCTGAAGGGCAAGACCTACACGATTGGCTTCCTGCGCTTCTGCAAGCAGGCCACTCTGCAGTTCTGCCTGGTCAAGCCGCTGGTGGCCTTCATTATCATCTTTCTGCAGGCATTTGGCCACTACCACGATGGCGATTGGAGGTAATGTGGTTTATCTTTAATGACCCGCGTTATTGCATCTGAAATGGTGGCATAAAAACAACGAGCGTGCGCAATAAATT TCTGCCATTAAGTAACACTTTGCAAAAGAGAGAACTTATAGGTACATATCATTCCCACTAATAATATCTCCTTATCTAAATTGCAGTGCTGATGGCGGTTACATTTACATCACGATTATCTACAACATCTCCGTGTCGCTGGCGTTGTATGGCCTCTATCTGTTCTACTTCGCCACGCGTGATCTGCTGACTCCGTTCGAGCCCGTGCTAAAGTTCTGTACCATTAAGTCCGTCATCTTCTTGTCCTTCTGGCAGGGCGTGGGTCTGGCCATCCTGGAGAAGGCCAATGTTATCTCGCCCATTGTAGACAGTGCAGGCACTGTTACCGTGGAACCCGGTACCGTCTCCGCCGGATACCAGAACTTCTTCATCTGCATCGAAATGCTGTTCGCCGCCATCGCGCTGCGCTATGCATTCCCCTATCAGGTGAGTTTTGGAATGTCGGAGTGGGCTAGATTTTACGCAGCTATTTACGATTTTTGGTGATTAGATAGTGCTGACTTGAGTGCTTTTTTTCGGTTATTTCGGTGTTTATTAAGCGGCTTTCCTTACACTTGTTAGATATGTGAAAGGTATTCGTGTAATGCTGACTTGGCTAGAAGAAATCAGCTAAAACGAAGTGCTTGCAGTAAAAATAACTTAAATGTTGTATGCTCTTTGTAGGTCTACGCACGCAGCTGCATCAGCGATGGCCACGGACGGTCTGTCACCATGCAGTCCATTTCCAGCAGTCTTAAGGTAAGCTGGAATATTTCCCTGGGAATTCCCGTATCTAAAACTCCCGCAATCCTTCGCAGGAAACAATGAATCCCAAGGATATTATGACAGATGCTATACACAACTTCCATCCGCAGTACCAGCAGTACACGCAGTACAGCTCAGGTTGGTTTTTACTCGCTTTCTCGTCTTTTTAGCCCAACTTCTTCTCTTTGTGCTCTGTGTCTGTGGCATGTTCGTTCTTTTCATCGAGCCTGCTTAACTTATCTTATCTCTTGTGTTCGTCGCTCTCATTTAATGCATTTCGATGCGAATTTCCATTACCATTTCCATTCCATTATCGTTATGTTTTTCACACTTTTGTTTTTCTTTCTTGTTTTCTTATCTTTTGCAGAAGTAACCTCGGCTCAGCGTTACGAAAAG


Search Again