CR01831

CRIMIC CR01831

Gene cyc

CG8727

Information

Donor Location Cytology FBti Stock number
pM37-p23L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence AGTGTGGATTTCCCGTGTAACGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GGGTACTGTGGAGTTGCGAA CACGGGAAATCCACACTGG CTTCCTCTTCCCTTCACACCC AGTTTCTCTTGGACCTGCGG
 
Amplicon 5' Amplicon 3'
GGGTACTGTGGAGTTGCGAACGTTGGGCGGAATGCGACCAATTGCCACAAGGCAGGATAGATTCGTTGTTTGCTCGTCGCTGTCGGCGTCCTGGTCCTCGTCCTTGATGGGTGTCCAGGACTTGAGGTAGCCCGTGCACTGGATAACCCGGTACTTGTGGCCCGTAGTCAGTCTGGACTTGCGCTTCGTGGAGCTCCGGGAGCTGGAGGACGTATCGGACTCCTCCTTGATCTGGTTGTTGCTGGCAGTGCGCAGCTTCATGCGGCAGAAGAAGGAGCGCCGGGCACCCGGACACAGGCGGCACAAGCTCTGTGGAACGTCGGTCTTAACGGGCAACATGGCTGCAGGTGATAACGCAAGGAGAAAACTTAAGTGACGTACTGAATCTCACACTTTCGCATGGCCACTTACTCTTCGCATCGATAAGCCTTTCCCTGGGACACTGTTCCAGTGAGGATAGCTGCTCCTTAACCTTGCCTATGTCCTTCGGATGCAGGACGTCGAACCAGCTCTGTCCCAGCAGGTCCGCTTGGGTGCTGTTCAGCACACTGGACACCGAATCGGAAACGTACAGGATGCGTCCTCGGTCACAACCCACCACGAACAGGAATCCCTCCGACGCTTGCAGGATAATCATCTTGAGCTCCTGGTCGGACAGGAAGCTAGGCCGGTAATCGGATCCGTTGAATGGATGTAAGCTGCCGCTGCCACGGATCCCTCGCAGATGCTGCACTGCCATCCGGAGCACAGTCAGTTTGTCCAGCTTTCGCTGCATCGCAAAGCACATGGGAATCATGGAGGAGAGCTCGTTGATGTACGTGTTCATCTTGTCCCGACGCCGCTTCTCGATCTCGCTGTGATTTTGCCTAATTAAAATAAATGATATAACGTTAAAATTATAAATGCATATGGATGCAGGAATCTGATTGAAAAGACCAATTAACTTTTCCGAAATAATCATTATTAGTCTTGAAGTCGAATAAATGGATATGGAATTAGTTAAGCCTGAATAATGTTTTCCGTACTTGCGATTTTCATCCGAGGTTCTAGCTGACTTCTCCTCGTCGTAGTTTTCATCTTCGATCTCCTCCATATTTTCGCTAAATCGAAAACAACAAATGGTGAATTAGAAAACAACCCCGATATTTAATCAACCAGTGTGGATTTCCCGTG CTTCCTCTTCCCTTCACACCCACACGCACACCTGGCCAACTTGTATGAGCGTGTGTGTGCTCGTTTTCGCGATTGTGCGTTCGTGTGGGTGCTTAACGCACACACTTACAGCTCGTTTTTATGCAATGTGTATGTAATTTGCAATGCACTTTTCCAGTGAAACTCACCAGAACTCCTGAACTTCCATCGCCAATCGGTGACGTTTGCTTATGAAAAATTAAGCCCTTTCCGACGAAGACCTCCCTTTTGTTTGTTTACTAACATCGACTAGCATCAACGTCCCAATAATAACATTTAAAACGGAAGTTTGTGCAGGCCGACAATTTGTTGCAAGCTTTTCCTGCATCTTCAGCTTCGAAGCTGCAGTGTGAACGTGGCTGCAAAATATACCAGCAACTTTCGGAAGAATACCAAGGGAAACAAGCTTTTCGCTTAAAAATACCATTTGGCGCCAATTAACAACGGTATTTAAATATTTAAATATGAAACTCATATGAATCAATTTTCATTATTTTACTTTGGCTAGACAATCTGAGTAAAAATCAACACAAGTCGAAACAAACACAAACAAACAATTAAATACTATTTATATTTGATCCTTAGTTTAATCACATCTTAAATGTGATACATTTTATCCAAGCATATCGTTATGACCTGCATATAGCGATCCCAAAGACATCTGGTTTCTTGGTCCCTGCAAAACATTTAGAGTTGATTATCAAAAAAGTTACTTGATTAATCTAGACAAAAGTACCCACCTTGATATTTCCAGATCCAAAACGCTTTGCGTTATGGAAGCCAAAAATTTATTCACTTGCTCACGGTTCCAGCCATTCTGACGCCAAGGATCAATAAGCTTCTCACAGAGATCGACGAAAAGATCGCGCAGCTCCCGATTGCGATGCAAATTGCAGGCGATGGTGATCAGGGCGCGCCAGTAAGAACTGCAAATCAAAACAGATCAATAGTAAGAAAAGGTGATAATGTCGAGAAATAAGTCCTTACCGAAAGTTGCCATCCAGTTCGTGAAAGGCGCGCTCGAGAAGAACGGGTTTGAGGCGCATGCAGACGAGGCTAAATGCAAGGACTAAACTATATAATAGCTCGTGTGCGGTAGAAAAATAAATCTCACTGCTTAATCTCCTTTTCCTTGTCGAGTAGACAGCGCAACTCCCGCAGGTCCAAGAGAAACT
 

Search Again