CR01804

CRIMIC CR01804

Gene ssp2

CG9028

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 long band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATCGAGGTGCGTGTCACACCCGG

Amplicon 5' Amplicon 3'
TTTACTTCCTGCCCAGCCAGCGAAAGTCAATCAAGCAATACGCAAATAAACTATTTGCGTACAATTAAATAAACAATTACCACCGAACTAAAGACGAGGATCAAAAATCGATTAGGCGATTTAATTTGAGTGAAATATTGTCATGCTGAGCTATTTTTAATGATTTTCCAAAGTGGAATGCCAGAATTCCAAATATTGCTAAAAATATAAGTTAAATAAAACTATTTACAACAAAGTTCATACTTAATAGTCATTCCTGTAAATGTATGCAATGGTTAAACTCAGCATAGATAAATATTTTAAATAGCTTAAATAATATATACAAAATATTCTTTTAAGCGATAACAATAGTAGAAGTGGAAGTAAGAAAATTACGTTAACAAACAACAATTACTTATAATTATATATGAAAGCTTCAGGGCGTTTATCCAGTAAGTTAAAAAATAGCTAAATGCTAACTTAACGGTAAAATATCAAATAGTGTGCTGAACACATCGCTTTTGCGAAGCGTCCTTTGGATCTTTACTAACACTAAAAAAATTGTAAACTCCCGGAGATTGCTAGTAGTGTGCACGGAATTTAATTACTGGGTTTATTTCCTCAAAAGATTTTGTAATTTTACTAGTTTCCTGAAAACTTTGCGATGCAAATATTTGCCACTTTCAAATCCCACGAGCCGGACAGCCGCTTGATCCAAAACTTCAAAAAGCACGTGAATTCGCAGTCGCCACTTGACGATTTGCGAAAAAATCTAAATGAAAAAAGTAAAATTCGAGAATATGTACAAGAGCTGATTGGAAATGAGCAACAAATGGGATCCGTGCTGGACACGATCTCTTCCACCGAAGAGGACCACCGCGTGGCCACTGTGACCGGATGGTCCACGGTGAACATCGCCAACTGCGCCGGCGTTTCCAATTCTTCAATTTTTGTGGCACTGAAGTGGGTGATGATGCCCATTAAGGTGGAGATATTCAACTTCAAGCGAAGTGGACCGGAAGATAATATGGCACGTGGACAATTTCTGTTGGACAACCTGTTAAGCGCAAATCGCCTAAAACGCTTGCAAGAGGAAGTAGCAGTTATTAACACGTGCCAGAAAATCGAGGTGCGTG CGGTCTGCCCAAATCGATGATGTGTGCCCAGATAACAGACGAATTTACAACTGCCATTCAGGAGGCCCTTAGATCACGCTATGAGGTGGATTCACGCACCTTAGATCTCTCCAGGTTCCACGCCAGTCCGGAGTTGTCTCTGCACTTTTGTCCGCTGCATATGGTCAAGCTGCTAGAAACAGTGCTAGTTCTTTCAAACCATTTATTTCCCCATGTGACCAGCCTAGTACTGAGCAACAATTATTTGTGTTCCCTGAAAGCGTTTGCGGGAAATTCCCAAAGTTTTGCCAGCCTAGAGCGGTTGGACATAAGCGCAAACAGGATTCAAGATTTGGGAGAACTCAATTACATCAACAAACTGAGTTGCAAGACGATCTTCTTGGCAGGAAACGGTTTGGCCAAGCTAAGCGTGGACGTCATTCGAAAAATGCTACCACAGTTGAAAAATGTTCATGGCTGTGTGCAGTTGGGGGAAAGTACAGAAGCTGTTGATAATATTCCGAAGTCTCAACAACTTCAAGGCGGTGGGACTAATGGTTTAAAGTTTTGCCAGGACTTCATAAGTTCATACTACACTTTCTTTGACGATACCGAAGAGCGTTTCAAACTTAAGAAGTATTACGACGACCAAGCCATGTTCTCGCTTAGCGTGCCGGTACAACTAAATTATGTCTACGGCTACAAGCTGTACAACAGAAACCAGAAGCGCCAGCATTCCTCGTTTGCACAAAACGCCAAGCTGCAAGTGGGTAGAGCTGCGCTACTTCTCGCTTTAAGCCGCTTGCCTTTGATGCATACAGACTTAGAGAATGTCGGGCTAGACATCCAGGTGTTCACTTCGAGTCTACGCATCTTTACGTTGACGGGATACTTTAAGGAGATATCATCGGATACTCTGGAACCACGACGCTTTCAGCGCACATTCGTATTGCA


Search Again