CR01772

CRIMIC CR01772

Gene CG3408

CG3408

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CAAAGCACTTACGTATTTCGGGG

Amplicon 5' Amplicon 3'
GCGCAATGCATCCGAGATTTTTTTTTAGCGATTTATTCCATTTGAAGCCCAGCGCTCTAAGGCTTCAAATAAATGAACCGTCAGTGTTCCTCCGGTGGTGTTCGGAATTCCGAGATCCAGTCGGTAACACGCAGCCGAAAGATCTCCGTTTTGGTCAGGATCCAATCGCGATACTGGTGTGGTATATACTCCACCAGCTTGTCGGCGATGTCCGGATTCTTGAACATGATCATGTAAATGATTAACAAGTTGATGATAAAGAGAACCAGAAAGCTGACCAGCGACGATAGGGCAGCTCTCGACAGTAGATTCAACCAGGAATCGCCTTTCGAGTTCTTTTTCTTTTGATTGTTCTTTTGAGTTGATTTGGATCCCAGTGCGATTGCTCCTGATCCTCCTGATCCCACTGCATTTACTGGTTTGATTGTCAGCTCATTGTCTCCCCCACCGGCGAGTTTTTTAGCTTTGGCTTTCTTATTATTCGGTTTCGTCGACTTCTTTCCACCAGCTGCGCCGCCATTCGTTTGAACGGCGTTGGCACTGGAATCCCCGGCTCCGGCCATTTTCTGGCTCTCTTGGGCGGCCAAACGTTCGCGTTCAATGAATTCCGGCTTGTAGTTGGCGCAGATGCTGACCTGGAAAATGGAGAAAAACCGGAAAAATGTTAGATGGAGCCCGACACTGTGTCACTCGAGGGCCACTCAAGTCGAGGGCCACTTACTGTATTCTTGGCCGCCTGCTGGCAGTCCTTTTGCGTGGAGCAGCAGCCCACAATCTTCTCCCAGGCGGGCGTCAGTGGATTCCCCTTCAGGTCTAAGTACCGCAAACGACGCAGCTGACCGAAGCTAATGGGCAGGTGCTCCAAGCAATTGTTGTACAAGTCCAAGTGGCGCAACTGCTCCAGCTGGCCAAAGTCCTCGGGCAGGAATTTTATTTGGTTCTTGCTTAGGTCCAGGCGCACCAAGCGTGTGAGAATCGAAAAGTTTTTCTAAGGCAAGATGGGGATGTCCGAAAAAGTGGCATTTAGGTCGTGTGCTAGGTGGCTAGATGTGGTGCGGCTACTTACTCCCAAGTTGACCAGACGATTGCTGGAGAGATCCAAAACGGTGACGCGCTTGAACGAAGCCTGCAAAGCACAAGGACAAACCGAACTGAGAACCAGTGGCAAAACATGACCG CGTAAGTGCTTTGAAAGTCCCTTTCTTTCAATTTACACCCCTTAGTTATTGACAAAATTTGGGGTATTCTGTTGATCATTTAATCTCTGTTATAGGTCATTTATTATTAGTATGTTCTTTTGTTTCACTAAGTTTTGTTTCTTTTTTGTAATCTAAGCTGGATATTGCTTATTTTCCAGTTATAAGGAAAAAACATCAAATATATATCTATTATTTTTTATATTCTTTTTTAATAATTAGTACTCGGTATCTGGTGGTCGCGACACTCTACACTTAAGCTACCATACTTGTTTTTCTTTTTTGGCAACCATCTGAGTTTTTGAGGGGTGGCAAAGACCAAAAATCAACCCCCTCGAGCGAATTCAACTGCATTCGCCGGCACACAAGGGTTAAGGGGTGTGTGGAAGTCGACGTCAGCGTTAATTGCAAGCCAGCCGGCAAAGCAACAACAACAACAACTACAACAAGAGTATGCGGATCTCTCTTTATCCATGCCAAACCGCACCCCCCACCACACGGCACTTGTGCAAGTGAGACAGACAGTGACTAGACATTCGCCAGACAACAAACGTGGACCCAAGAGGAAGCGAGAGGGGTGATGGGAGCTGATGCTAATTACTTGTATTTCAGCTTGTACTTACGATCTCCCGCACCGGTATTTCGCTCAGTTCGGAGAGACTCAAGTCGCAGGTTTCGTCCACCACCCGCTCCTTGACGTTCACCTTCACCTTCGCCTTGTCACCGGGTTTCGGCATTTCGGCGACACTTGCTTATCACACTATTTATACGCGATTTATTCCGGCTGCTGTTCTTCCTCGTCACTTGGAGTTTGTGTTTACCCGAATCTCAAGTGATTTTCAAACGTTCGTTTTGTGAGAATGGCAATTTTGCTGGCGAAGCACACGAAAGCTCGGGAAATAACGAGTACTAAGTTGATAACGGCAGCATTTCGTTAGATTACTTCTCTGGGCACACTGGAGCCTTATCTGGAATTGCAGCTCTGACCGGGTATCGAT


Search Again