CR01769

CRIMIC CR01769

Gene barc

CG6049

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTGGCCAGCCTTATGCGCTCGG

Amplicon 5' Amplicon 3'
TTCAGCGCCAGATTGACACTCTCCACCTGAAATAGAAACAAACTAACTAGTAAATGTTTCTTCTAGGTACCACAGGCGTGTCAAGGCCGAGGACAGTGACGAAGAGATGATTATTCCCGACCGTCGACGCAATAACAATCGTCGCAACAACCACAGAAACCGTCAGATCAAGAATCAGAATCAACATCCCAATGATGTGAACTACCAGCCAGCACAGCAACGCCAAAGGAATCGTCCTCGTACTTCTACTGTTGCGCCAACTACTACGCAATCGGTTAGCCAGTCTAATGATGTCCTGGCTCCCTCACCCACGCCTCAGCAGATGACTCAGTACGATCGTAAATTGCAACGTCAACGGGAAAGGGAACGTCGCCGACAGCTGCGTCGGCAGGAACGCCAGAAGTTGGCTAGGGAGCAAAAGCGCGAAAGGCAACGTCGCCTTAAGGAGGAACGCCAGCGATTGCAGCGGGAGGAACAGCAGCGCAGGCAGCGATTGCATCACGATGAACCCAAACCCCAAGTGAACCCCCAAGTGAAGCCCCAAGTGATAGATGAACTCCGTCAGAGATCTGGTGAGGATTTGGATAAGAATCAAACGGACGAGCACGAACAGAAACTAAGAAATGAACAGGAAAAAAAACTAAGGGAAGAACAGCAAAAGCAACGCGATGAACAGGAACAAAAGGACAGAGAGGAGCAGGATAGACTTAAACAAGAGGAAGAGCAGGCCAGAACGCATCAGAAAGAGCTCAAGGAAAACCAGGAACAGCAACTTCGCGAACTTAAAGCCAAGCAGGAGCGAGAAAAGCAGGAACGGGATTACCAGCAGCAAAAGCGTGAGCACGAGCTCGAGCTCCTGAAGCAACGGCAGGCTGAAGCAGACCGCCAGCACGCAGCGGACGAGGAGGCAGAGAAGCTACGACTGGAGCGCATCCAAAAACAACGCGAACTGGAGGCACAACAGCGACGAGAGCGCGAAGAGCAGCGCCGCAAACAGCGCGAAGAACAGGAGGAACAGGATCGCCAAAACCATGCCAAGCGTCTGGCTGAAGAGAAGCGACTGCATGATCTGTATGCCGAGC ATACCGAGCGGGAGAAGCAACTTGCCGAGGCCCATGAAGCCAAGCGACTTGAGGAGCTGAAGCTGCAAGAGCAGCTTAAGAAACAGGAGGACGAGCGGCAGGAGCAGATTCGACGCGAGCAGGAGGAGGAGGAAAAGCGCCTGGAACTGGAGAGGCTTGAGGAGGCTCGCCGCTTCGAGGAGAAGGAACTAAAGCGCCTGCACGAGGAGAACCAGCGGCGCGAGGAGCAGAAGCTCCAGCGCGAGCGGGAAATAGCACTCCGCGAGGCTGCGGAGAAAAAACTAGCTGAGGAGGAGGAAATGCTGCGCAAGGAAGTGGCTGAAGAGGAACGCAAAGTTAAGCAGCGACTAGAAGATGAAATGCGACAGGCAGAAGAGGCGCGTAAAGCCAAGGAGGCCGAGGAACGGGCTGCCGAAGAGGCCAAGGCCGCCGAGCAGAAGCGACGCGTGGAGGCGGCCAAAAAGAAGGCCGACGAGGAAGTCAAGGCTAAGTTGGAGGAGAAGAGGCGTGAGTATGTGACTCGAATCTCGGCGCTGAGTCCCGAGGACCAGAAGAAGTTTATCGAGATGCGCAAACGGCGCAAGCAGCTGAAGGAGAAAAAGGAACGTGACCAGCGGGCAAAGGAACTGAAGAGGATACAGCAAGCCATGCGATTGGATGACAACGAGTAGAAGTCCAGGCGGCAGTCAAATCGCCACGCACTAACCAATACTAACCGATACATATCGATCACAATTGGTTCCACATACGCACCGTTGCCCAGTCGATCCCTTTTCGATTGTTTTCTTTGTGCTTTAATTAAAACAAACCACAAGATGAACACGCAAAAGTATTATTTATCAGAAGAGAAGGAAGAATGGAGGAACATCGCTGCGAAGCAGATTTTGTCGGTTAATTAATTGCATTTCGATCGAGCAGGAAACCCAATCTCCATGCGCTTCGCTAGCTATTTTAGTACTGTACAGTAAAGATATACTATATATAGGTCTAGGATATGGACACGCCACATACTCACGCAGCACACAGGACACACCGTAAACACACGGCAACCAGTCACGCATGTTT


Search Again