CR01753

CRIMIC CR01753

Gene CG7841

CG7841

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GCATTGCCGCGAAGTTACGTTGG

Amplicon 5' Amplicon 3'
TTGAAGTCCTGTAGCGCTGGACTCGGTGGCTCCACCCAGACAGTGGCTGTCGAGGCAGCGGGCACTGGGCTGTTGGCCATTATGCTTTCCACTGGACTGGCGGCGCTGTTGTTGTTGGCATCCGCTACAGGTTTCTCAACAGGCTTGGCGGATGAGCTCGAGTCGTAGGGATTCTGCGCCACCAGCATGTTCCAGGCTGCCAAAAAGTAACAAAAGTAAACCACATTTATTAAATACTTATAAGTACATCTTTACAATCATATTTCCGACTTACAGTCATTTATGTAACGTATTATTTCCTCATGTTGCGGCGTTATCACCTCATCCTCGATCAGTTTGGTTGGCGTTATCCGCTTGGTGGCGAAGCTCTGTTGAAACACCGGACGCGGTATGCTGTTTTTTTAAAAATCAGGAAATATGCATACAATTTTAATAACAATGTTCTTGAATTTCAATGAAAAGGCACTTATGCAAACCACACAGATTCCACCAAACATGTGGACTACGAAAATAAATCACTTGGAGAACGAGGTGGGGTAACTTGGGTTCGACAGCTTGCTACTCAGTTCGAGGAACGCTAAATGCATTTTAATTCGAGAAAGGCGCTGCAGTTCGTCGATTACATTATTTTGGCTTTTAAATGTTAAAATTACATATCGATGAAAAAATTACAAACTCAATATATACTCATAAGAGCAATGAGTACTGATAAGCTATCTACAGTGGCAGATAGTAAACAGTGCCATCCCATTGACTGACAAGGATTTGTGGTTTATTAATTTAGATAATAGTATTTCGGCAAAGGGTTAGGTAATTTTTATCTTGAAGTTCTAAAAATAAAAGCAATCGCAAGAAATTAAATACAATTGGGAGTTTATAAAGTTAATATTTATATAGAGAACTTTTCAGATTTCAGCTGAAATGGCTATGGGAAATTCTAGAAAACTCGCATCCATAAGATACTTTTAACAGCAAGCGTAATACAGTTGATATAAAAGGCATAAAAATAAACAAGAAATGAGATACACTCTTCAATTACCTATAAGTACTCTACTCTGAAGTTACATGTTTCGATTGCAGTTAGACATTCGGAATAACTCCACACCCTTCCAGGTAAAATAAGTAAATTAATCAGCCTTGTTTTGGCACAACCTGTGCCGAGCATTG TTGGAGCCGTGACGTAACGGACGTGGAAAAGTCAATGCCTCAATGGCCTCAATGGGCATTTAAATTAAAATGGAGCCGATAACCGACGCCTGACCCACGTGTTTCCAATGGGTCTCCCCTAGCGAGAATAAGACTACTTGCTCGGGAGCAATTAGCATTACTGTGCTAGGTCGCCACGGATTCTTGCGATAAAATGTCAGTGCGATAAGACGAGGGTCTTGAACCCCAGTCCGCGTTTTCCCCCGTCACTTTTCCCGCTTTCCACATTTCACCATGTGCCATCCGTTTGCATAAGCACCCAAGATTTGGGTATGGTTACATATGAGCATGGCATTCTTACTTTTTGTGCTCCTCGGGACTGTTCAGATCGAAACTAGCGTTCTTGCGGCCGCTCTCCTTGATGCTTTCGAATTTTTCAAAATTTGGTGCCAGGCCTGCGGATGGAAAACATGCCATGGAAAGCTATAAAATACGCATTTACTGTGGAAAACGCCGGCAAAACAAAAAGTTAACAGAGCCAGAGAGCAAGAGAGGCAGAGGCAGATATATAGAGAGAGAGAGAGAGAGAAAGGAAAAGAGTATGTTTTTGTGACATAACAGCTGTTCTCTTGAAAGGGTCTATTGTGGCATTATTAACCATTATTACTATCAATATTTTGGACTCACCGCGACGCGTTTTAGCAACAATTTTGCTAGGTCCCTTGTTGATTGTGTACATGGTGGTGGGGAGATGGGGAGTACCGGCTGAAAATATACCTTGTCCTTTCGATTTACGTATTGTTGTTTTCGTTTCTGGCAACGAAATGCCTAGCCGACTGCTATGATTTTGAGTATTTTTCCGCTCTAGGCAATCATATGATCATTGGCAGCCCAGCCTGCCCCACGCCGCCTCCTTTTGGCCTATTGTCATCGTCTCAAAAGGTTACACAATACACTTCACTTAGGGCAGTGATTCCGATTTAGCACTCTTTGATTTTGATGGCTGCCGCACCGCGCTCGTATCAATTGTTTTCGATTAAAATCACCGACAATTACTCCTGGAAACGCGTTTGTAATGTTCTGTGTTCGGCGGACGAGGCTCCAATGCAACTGCCCCATTCAAATCGCATAACGAAATGTTAAGAGAGACACCCGCAAAGAGCCGTATGTTAGGGCGTTCATGCGGCAGACAACTC


Search Again