CR01734

CRIMIC CR01734

Gene unc-13-4A

CG32381

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGACGCAGTCAAAGTCAATGTGG

Amplicon 5' Amplicon 3'
TATCTGGCAGCCAAGTTGGGGCAAAATATTAGCATATTCATCTGTGGGTTAATTACCTCCAGCAAACATGCGCCTCCACCCATTCCATCTGCGACCCAATCTCCGCCAGCAGACAGGCATTAAATTTGCCAAATCCATTGGCACTTCATCAACTATGCATTAAGGGCACCGGACTTGGATTTGGTCTCGGTTCTGGCTATGATTATGACTTTCGACTTACCCGGAATTGGAGCGCGGATCCACTTCGGGCCAGCTCAGGCGGCGTTTGCAGAAGGCCAGCGGCGGACGTGGCGGCGGATCCGGTTGATGCAGTGGCGAATTGCGCTGCCTGAAGGATCCGGTGCGGGGTGGAGCCAGGCATTCCAGGGCCCGTGACTGGCGACGCGACTGGGGCGTGCCACCTGGCCCAACGGAGCCGGATGTCGAGGGACTGCCGGGTCCCGCGGCACCACCTGGTATTTTGGGGTAACCTTTTTGGGGAAACATGAGAAGGGGTAAAAGCATGAGCTGAATTACATAAATCAATATGGAGCAGGTGAGCAAAAGTTAATATACTTATTTACAATAATATGGTTTGTATTTGGTTTGACTTTCATGCAAAAATATAAATCTTCAAAAGGTACAAAGAAAATAGACACGTGTTTGTTTTCCCTTAGTTTTCACCATGCTTCTGTGAACTTTCTTCACATCGAAATAAGAAGATTGAACAAAGTCATACGAAAAGTTTGATCTTCGAAACTATTTGCCCTGTGCAATATCCTATAATTTCCCGCAACATGCAAATATCTATGGAATACAGCTAGCTGATGGCACCGCGCTCATGGAAAGTCAGGTGTGTAAGGAACGACGCAGTCAAAGT CGATGTGGTTCCGTGTGGTGCAGTGGTCCGTGCTGAAGGCAACGGTAGTGGCAACTGCAACGGCAATGCAACCGCAGCCCGCAACCTTGACATGCATCTGTGTGGGTGCTGCGGCTCCTGCAGCTGGTCCTGGTTGCCACTCCTGGCTGCCAAGGACTATGACTACGGAGGCAGAGAGTGCCTGTGGTGCGGGGTTTCGGATGGAAATAGCTAACCATTGATGTGGCTATGAAAAGAATGTTTTATTTTTTTTTGTCTGGCCAAGTAGCGGTGAAGCCGGGCCAACTAAAAAATTTCAAAGAAAAGCAAAGAGAAGAATACGAATATGCGCTCGAATTTCGGTTTGGTTTAAAAGTGTGCACAAGGCGTAAAGTCAAAGTTGGACTGCATTGGACTGCGGAATTGGGAAAAGCGCTTACACACGTTGATGGGATATTTTTTTTTTTTTTTTTCATGGAAACGACAATTCCCCGTTGGCAGCTGTTTGGCCAGGAAAAACCGCTCGTTCGCCGCTCGTGCAACAAGATAAGCCAATTTCAAGTTTGATTCAAATGCTGCAGACGTCGGTGAATCAAAATCCCAGCCAAATGGCAAGTCAATGTCGTTGGCAATGGCGATGGGCATGTGATGGCTATGGCGGAAAGTTCAGGATCCGGCGGTTTGTGGTCCTGCTGATGCTGATGCCACTGCTGCGTCTTGACATTTAAATGTGTTTGCATTTGCCAACTGCTATAGAAACAACAACCTTGTACATCGTTTAGCTTGGCAAACAAGTTTTGCATAGCCAAACGGAGCCAAAGCGGAAACGAAGCCGCACAAGAAGTCACATATGCATGCTGATTGCTTTCGCTTCGCCAGCTATCATACACTGAGAGAAACAAGTGCTGCACGAGCAAGATAGTTTTGTTTATTTAAATTAAAGATAGAAGATCCTAATAGTTGTGCTCTTATATCTTTAGATGCAATTTAGTTGGCTTGGAATGGTTTTTGCTATTATACAAATTTTTTCCAAATTTTAATTCTTTGTGTATAAGCCACTATCAGCCACCAGAACCAACTGGCACCCCATTGCGGTGGTTTTGTCTGCACATTTGTTGATCCATATGCGAGAGGCGT


Search Again