CR01724

CRIMIC CR01724

Gene Msr-110

CG10596

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TAGTCACGGCTTCCCACTGCTGG

Amplicon 5' Amplicon 3'
TCGAACGATGCGAGCCATTATTAGCCAACTCTATAATTTTTTAAAATTCAGTGCCCCATAGAGCACGATACTAATCTGCCATGGCAACGGATCATTGAAGCACAACGGATTGTACGGATTGGCATATCGGTTGGAATACATATTTCGCGAACTCACCTTGCCCACCTGCTGCAAAGTCTCAAGCATTAGCTCCTTTTCCAGCACCGAGTCGAGGGCCTGGACCTGATCGCACGAGGCCTTGGCCTGCAGGTAGGAGGAGGCCAGGATGAAGGATCCCAGGATGAAGGCTGACACGATGATGGTGAAGGCGGTGATCTTGGCGATTTTCACCGAATTCGCCTGGCGCTTGTAGGCCTAGAATGGTACAGAAAATCACATTAGCTTTGCGGTTTTTTTCAATGAACATACATAGTTTTTATTTGTGTTTGCAATTCAATATTTCTACGTGCTCATTTGCCTATGACCTCTCTGTGTTTCGGTTTTTTTTTTGTTGGGGGTAAGGTAAAAGCGACGACCTTACTCCACAAAATACACCTCAGCATGGTCAAGCGCGTTTTTCGCTTCAAAACGTCGAAGTTTTCGAGAATTTCAAAGAAGTGCTGGGTGCATAATTTGTGATTTTTTGTGAGTGATAATAACTTATTTACATAAAATGTGTAGGGGTTACTTCAGTTGCGACTGTTTTAGGATGGGTCATGCAATTTCATTAATATTTTATTATCAATGGGCTTTTAAGTGCTGTTTCCAGTTGACAGAGGTTGCTCGGCATTAATCATTAAAAAGCCAAACAGTCAGCTATAAGATGAGACCCAAGGTAATGAACAATAAGTGATTGTTAAAGGCATTTAAGTTTTTGGCAAGTGCTTTAATCGAGAAGAAACTGCGCCTTAGATCATCGCAA AGCCGTGACTAATGTGCACAACAAATGCTTTCCGCGTAAGGTGCAAAAATTTACAAGTGGATGCAAAAAGCCGCAGCATAGGGAGTATCCACAAAAAAGTTAGGCCAGCCAAATGAATTCCGCATTTGAAGATTTTTTGTTGCGCAAGAGGAAACCCTCCGCAAAATTGAGGAAGTGGCAAGCCCAAGAGAAAAGGCAGTCTCGGGTGTGGGTGCAGTCAGGTGAGGCGGCTTTTTCTCGGTTATATCTATATCTTTTTTTTTTCTGAAATGTGCAATGTTTTTTGTTAACACCTCTACGTGCGTGGCTGGCGTGGCCCCAAAATGCAGTTGCGAAAGTGAATTGTGAGTGAGTGAGTGATCATCATCATCATCAACACCAGGCGAAGTGAAGTGGAAGTGAATGGCTCGCCTGGCACTCTATTTTACTCTACTCTACTCTACTCTACTTGATGAGGTTTTAATTTTTTTGCGTTTTGTGTTTTTTTAAACTTTTTTTGTGAAGATTTTCGTGCAGACAAAAGACTTGAGCGACAAACCTGATGATTAAAGTTAAAAAATCCCATCTGTGGTTGGTTTTGAGTGTTTGGTTCGTTTTTTGTGTGGTGGCGAGTGCGGGGGAATAGAGAAAATTTCATATTGTCAATCACGGTTTCGGGAATGGTTTGGGTTTCGGTTATTCGCATTCACATTTTTCAGCCAAACCAAAGAAAAACGATTTTTGTGGTTTTTGTTTCGAGTGTTGTGCACACACACACACACACACACACATTGCAAGGTAAAAATACATAAAAACAAGAAAAGACAAAAAGTTAATGAGATTGTACTGCAGTTGTGTGTGGGGTCGCTTAATAATACTTAAGGTGAAAACCTAACACATATGGCGCAAAGGTAAACAAATACTGCACAAAAGGGAAAGCTCTTGGCCAAGGGTCGATTGTGAAGGCTAAGACAGAGCTACTGACATATTAGGTAACTCATTGATAGATGAACTCTGTTATAGAAAAGGTCAGACTATTGGCTCTATAAAGTAATGGTTGTTATGCTCACTGTCCCATAATAGAACATCATAATAAAGGTAATTCTAGTTCACTTTTTGCATTCAGTACATATTAATGATAATTACTTTACAGATTTCAGCAGCACTGAGCATTATTCCTAATGGGTTTTTCTAATGGCTCGGTCTGCAGTCATTA


Search Again