CR01722

CRIMIC CR01722

Gene CG6083

CG6083

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GTCAATGTCAAAGCTCTTCGGGG

Amplicon 5' Amplicon 3'
AGAGCAACACCTACGCCTTCATGGTCATAAAACGCCCATTGCAGTCCAATTCGTTAATGGCCTGTATGTCATCGACGGCCAACTCAAAGTCCCAGATTCGCTTAAAGTTGTCCAACATGTGCTGTTTGCTTACTGATCTTGGGATGACAATTATACCCGATTGTGTCTGAAAGCGTAGGAGCACCTGTGCCGCAGTCCTTTCGTATTTCTCAGCTATAGCCAAGATGGTCGGATGCTGGAGCAGTGGATAAGCGCCGGGCTTCTCGTAGGGCGTATGTCCCGATCCCAGGCAGCTGTAGGCGGTCACAGCAATGGCATTGTCATAGCACAGCGTAATCAATGGCTTCTGACTAAGGTACGGGTGGCACTCGATTTGAAGAACTACCGGTTTAAGCTTGGCCACACTGAGAAGTCTATTCATCTGCTGCTCATTGAAGTTAGACACACCGATGGCCTGGCACAGACCCTCGTCCACCAGATTCTCCATTGCACGCCACGTGTCCACATAGTCGATGTCCTCGAATGCGGCCTTATTGGTGTCCGGACACGTGGGATATAGGTTGTCACTGCCCGACTTGTAGGCCATGGGCCAGTGCATCAGGTAGAGGTTTAGGTACTTGACTCCCAAGTTCCTTATGCTTGTCTCACATGCCGGGCGCACCAAATCCGGCTTGTGGTGTGTGTTCCAAAGTTTGCTCGTGATGAAGAGTTCATCTCTGCAGTGCAATATGTATTTATGGCTTAGATAAACGATTGATTAGGCCTGAAAGCAGCACTTACCGTGTGACCACTCCCTCGTCCATTTTCTCCCGGAGAGCAGCTCCCACTTGCGCCTCATTGCCATAGATATGAGCGCAGTCAAAATGGCGATAGCCTATATCAATAGCATCCTTTACTGCTTGGGTCACCACTTCCGGCGGGCTCTAAAATGGCGAATAAAACGTAAAAAGCTGAGGTGCATCAAAAGCTTTTGCTTGACCCCG AGAGCTTTGACATTGACCGTGAAATATGCAGTGGAAATGCACATTTCAGCTGGCTATTATTTAATAACAATATATATCTATGTAAAAGTACTTACCCGCCAAGTTCCGAGACCCAACATAGGCATATTTTTACCATTGCTCAAGAGAAAATTCGGTGTCGACATGTTTGAATCCTTTTGCTCCTTGTGAAATATGTTGTTGCACTGGCTTCGTTTTTGGAAAGCTTTAATTTGTAATTTACTAAGTGAACTATACTCAAAGGCCTATTAAACTGGCTAGAAACAGCATGTCTTGTGACAGCTCTGCTATCACAACTATATGTACGAAAATTGTTTAAATTTAGAATCTTTTGGGCAAGCAAAAGACCTTCGCGGAATATAATCGATTCGCTGCAGAGGGAAATTTTAAAATTTAAAACAAAAAACTCTTTTTCTGCGTTCAGAGTTTTATTTTATAAACCGAGTATAATGTAAATAAATACCTTTTTTTAATAAAATAAAATAAAATGTTAAAAAAAAAACTTTTGAAAAAATATTCTTTGTATTATCGCGTTATAAAAAACAAAGACAATCGATAGAAGTTTCCGATGAAAACATCGCATTCGCAGATAGTGCCTGACCTACCATCTCTAATTTTGCCGCCTGCGAAAAACACAAACAATGTTCGGCACCGTAAATAACTATTTATCCGGCGTTTTGCACGCCGCCCAGGATTTAGATGGCGAGTCCTTGGCCACGTATCTCTCCTTACGAGACGTGCACGTTCAGAACCACAATTTGTACATTGCCCAGCCGGAAAAGTTGGTGGATCGATTCCTGAAACCGCCACTGGACGAAGTTGTGTCCGCCCACCTGAAGGTGCTGTATCACCTGGCACAGGAGCCTCCTGGTTACATGGAAGCCTACACCCAACAGTCGGCAGCCTGCGGAGCCGTTGTGAGGCTTTTGCAGCAGCTGAAGGACGAGAATTGGTGCCTGCCACTAATGTACCGCGTGTGCCTGGATCTAAGGTACTTGGCGCAGGCCTGCGAGAAGCATTGTCAAGGATTCACACCTGGCCACGTATTGGAGAAGGCTGCCGACTGCATAATGGCCTGTTTCCGCGTTTGTGCCGCTGATGGACGAGCTTCAGAGGAGGACACCAAGCGTCTGGGCATGATGAA


Search Again