CR01719

CRIMIC CR01719

Gene fax

CG4609

Information

Donor Location Cytology FBti Stock number
pM37-p03L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK

Images

Construct Design Sequences

sgRNA sequence GGATGCACAAGCATACGTTACGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GCGCCTAGCTATATAGGGCC CCCGTAACCCCCATCCGTA GGTGGTGGAGGTGATGTGAG ATCACCTTTGGTCGCAAGGT
 
Amplicon 5' Amplicon 3'
GCGCCTAGCTATATAGGGCCTTACTATATAGTATCGTACTACATATGTATATATATATAATGTGTGTGTATGTGGGTGTTTCTGTTTCCTTCGATCATACACATATACTAGATATATGTACGCATATAACTAACGGCGAATTTACTTTGTTTCCTCCTTCTCTTTGTTCTCCTCGGTCGACTCCTTCTCGTTTGACTGCAAAATAGAAGGACATGGCTTAGTATGTGGCTAAAGGTAACTTAAATTCAAGACTAGAGGGTCTATCCTTGTCCTTGGTGTGTGGAATTAATTAACAATTTACAAAGAAAACCCAAGAATAGACCATCTGGTTTACAGGACTCAAGACTCACCTTGTCCTTCTCCAACTCCTTCTCGATCTTGTCGCCCTCAGTGCCCTCCTGTTCGTTTGATTTCTCCTGCTCGCCACCCTCCTTGCCCTCCTTGGTCTCGGGCCTGTCGGAAAAGCGGGAAAAATGAATTAGTACACCGATCATCCATTGGAAAGTTTTCATCCAAGATTACTCACTCTGGCTTGGGAATGTGCGCATTGAGGTCCAGCTTCGTGCAGATCTCGTCCCAGTCGGGGAAGCACTTGTCCTTCATGCGAGATACGTGGCCAATCAAGTTGGGGCACTTCTCGGTCATGTAGTCGCGCAGCGGATACGCAATGTCCTTGGACAGATAGTGGAGCTGCGAGAGGACAGCGAAGGCCACCACATCCAGGGTGGTGGGCTCGTCGCCGAAGAAGAAAGGCTTGCAGTCGAGCATCTCGCTGAGCACCTTCAGGTCGTCCTTGCCGAACTCCTCGATCTCCTCGGCGCTGTGGACACCGATGCCGTGCGCCTTCAGCTTCTTCGTGCCCTGGAACCACTTGTTGTGTTCAATAGTTGTTTTGCCGTACAGCAGTTACGGATGGGGGTTACGGG GGTGGTGGAGGTGATGTGAGTTTTTAGAGTTTTTTTTTTTTTGGGATCGGGGGCATTACGCATTACACAGTTAGATGTTCAAAACCAAAGTAGTATGCAAAAAAGAACGAAAAAGAAAAAAGAGAAAAACCATGCAAGAGTTAGTCGTAAAATAATGATTGTTTTCCTTTCGATTTCCCGTTTGGGTTTTGATTTTGATTTGGGTTGGTTATGTGAGAACCGATCGATTTGATATAAACAAATGCATCCCGCCAGAGAATTATTGTTTATGCCATCGGGGTTTTCGGGATAAACTATGTGCGGGGATGGTGGTGGTGTGTTTGGAGTTTCTTTTCTTTTTATGTACAGCTAGGTGCAATATAATACGCCACCGCTTGCTTAGTTTTAATTCTCAAGTATTGTTTATTTACACTACCCATCCATCCCCGCCTAATCCACAACGCCAGCCAACTCGAGAACCTACCCGGCTTTCGATTACGTTTTCAATCTAAACAAAGTGCGGATATCTCCGGTTTTTGGAACTACTGGAGGCTCAGCTGCTGGCGTTGAGTTTCTGAAACATCTAAATCCGCTACACTAAAAACATTTCTCTACTTGACTAGCTTCCGGTTTCCACTTTCACTTAGTTTGTCTGATTTCGATTAACACTGGAGTTCAATAGATTTCTTTTGGTTAAAGATAGAGTACAGTCTCTTTCAACAAAATGGTAATAATATTCACTTAAAGCTTCAACTCTTAAGATCACGAAAGAATATAATTGTTTAATATGCATTTATGAAATGTACAAATAAAAAATTGTACCAAAGTATGAGCTATTTGTAATTAAATGTTACTTTTACGAACAATAAAACCTATAAATTTGTTTTATTGTTCAACTAGAAGTATGTGTCAAAAGATGTTGATATATTAAGGAAATATTAGGTATGAATGATAGTAAACAACTTCTGTAGAACCAATTACGATAATGACCAAAAGTATGCAATGTTCCAATGAAAATTCTAATCATAACCATACAAATTCGGGGAAAGTGAAGATCGTGGACCACGATCATGACCTATGTATGTTAAATATCACAAACTATCCAGTTACCTTGCGACCAAAGGTGAT
 

Search Again