CR01719

CRIMIC CR01719

Gene fax

CG4609

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GGATGCACAAGCATACGTTACGG

Amplicon 5' Amplicon 3'
GCGCCTAGCTATATAGGGCCTTACTATATAGTATCGTACTACATATGTATATATATATAATGTGTGTGTATGTGGGTGTTTCTGTTTCCTTCGATCATACACATATACTAGATATATGTACGCATATAACTAACGGCGAATTTACTTTGTTTCCTCCTTCTCTTTGTTCTCCTCGGTCGACTCCTTCTCGTTTGACTGCAAAATAGAAGGACATGGCTTAGTATGTGGCTAAAGGTAACTTAAATTCAAGACTAGAGGGTCTATCCTTGTCCTTGGTGTGTGGAATTAATTAACAATTTACAAAGAAAACCCAAGAATAGACCATCTGGTTTACAGGACTCAAGACTCACCTTGTCCTTCTCCAACTCCTTCTCGATCTTGTCGCCCTCAGTGCCCTCCTGTTCGTTTGATTTCTCCTGCTCGCCACCCTCCTTGCCCTCCTTGGTCTCGGGCCTGTCGGAAAAGCGGGAAAAATGAATTAGTACACCGATCATCCATTGGAAAGTTTTCATCCAAGATTACTCACTCTGGCTTGGGAATGTGCGCATTGAGGTCCAGCTTCGTGCAGATCTCGTCCCAGTCGGGGAAGCACTTGTCCTTCATGCGAGATACGTGGCCAATCAAGTTGGGGCACTTCTCGGTCATGTAGTCGCGCAGCGGATACGCAATGTCCTTGGACAGATAGTGGAGCTGCGAGAGGACAGCGAAGGCCACCACATCCAGGGTGGTGGGCTCGTCGCCGAAGAAGAAAGGCTTGCAGTCGAGCATCTCGCTGAGCACCTTCAGGTCGTCCTTGCCGAACTCCTCGATCTCCTCGGCGCTGTGGACACCGATGCCGTGCGCCTTCAGCTTCTTCGTGCCCTGGAACCACTTGTTGTGTTCAATAGTTGTTTTGCCGTACAGCAGTTACGGATGGGGGTTACGGG GGTGGTGGAGGTGATGTGAGTTTTTAGAGTTTTTTTTTTTTTGGGATCGGGGGCATTACGCATTACACAGTTAGATGTTCAAAACCAAAGTAGTATGCAAAAAAGAACGAAAAAGAAAAAAGAGAAAAACCATGCAAGAGTTAGTCGTAAAATAATGATTGTTTTCCTTTCGATTTCCCGTTTGGGTTTTGATTTTGATTTGGGTTGGTTATGTGAGAACCGATCGATTTGATATAAACAAATGCATCCCGCCAGAGAATTATTGTTTATGCCATCGGGGTTTTCGGGATAAACTATGTGCGGGGATGGTGGTGGTGTGTTTGGAGTTTCTTTTCTTTTTATGTACAGCTAGGTGCAATATAATACGCCACCGCTTGCTTAGTTTTAATTCTCAAGTATTGTTTATTTACACTACCCATCCATCCCCGCCTAATCCACAACGCCAGCCAACTCGAGAACCTACCCGGCTTTCGATTACGTTTTCAATCTAAACAAAGTGCGGATATCTCCGGTTTTTGGAACTACTGGAGGCTCAGCTGCTGGCGTTGAGTTTCTGAAACATCTAAATCCGCTACACTAAAAACATTTCTCTACTTGACTAGCTTCCGGTTTCCACTTTCACTTAGTTTGTCTGATTTCGATTAACACTGGAGTTCAATAGATTTCTTTTGGTTAAAGATAGAGTACAGTCTCTTTCAACAAAATGGTAATAATATTCACTTAAAGCTTCAACTCTTAAGATCACGAAAGAATATAATTGTTTAATATGCATTTATGAAATGTACAAATAAAAAATTGTACCAAAGTATGAGCTATTTGTAATTAAATGTTACTTTTACGAACAATAAAACCTATAAATTTGTTTTATTGTTCAACTAGAAGTATGTGTCAAAAGATGTTGATATATTAAGGAAATATTAGGTATGAATGATAGTAAACAACTTCTGTAGAACCAATTACGATAATGACCAAAAGTATGCAATGTTCCAATGAAAATTCTAATCATAACCATACAAATTCGGGGAAAGTGAAGATCGTGGACCACGATCATGACCTATGTATGTTAAATATCACAAACTATCCAGTTACCTTGCGACCAAAGGTGAT


Search Again