CR01694

CRIMIC CR01694

Gene sbm

CG9413

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AAAGGGCAGCCCTAGAAAATTGG

Amplicon 5' Amplicon 3'
TGGAAGGTGTGAGATTCCGCGAAAGTTTGGCTCCTCGCCAGCCGTGCAACAAGTTGTGACGAGAGTGCAGGGTCGAATTTTGGGACTTGGCCACTTGACGTCGTTAAGTGGGTCAGTTGCACGTGGCGCACATTTCGGGCAGGAGGGGATTTTATGGTTCTGGTGACTACTTACCCAGCAGAGAGAGCACACCACAGGCAAGCCAGATTATAAAGCTAACTCCAACGGAACCAGTGCGAACCAGTAAACCGGAGGGTGACACAAAAATTCCAGACCCTGTGGATTGACAAAAGGGAGAAGATATAGATACAGAATATAGATATAGATATATGTAGCTGCGAATATAGATATATGTTGATATAAGTAAAATGCTGCCACAGCTGCGCTTCGGAAAAAACAGCTGATTAAGGGCCCACATTGTTTTCCCTACTTTCCCCATCGTTTCGATTTCCCGTATGCTAATGAGCGGCTGGCGGGGCTCTACATAGTACATATATACCATTTGAGTGGGCGTTGCGGACGTCATCAGTGGGCGGACAAAAGTTTCGGCGAAAGCTCCGACCACGCGGCGAATGCGCAATACCGGCAAATAGTGGTTTTTCCTTGCAGAGAAACTCACACAGAGGTTGTATGAGGCCGGCGAAGCGGTATGGAAAAAATATATGAAGTTCGTTGGATATTCGATCCAGAGGCGTGCAACAATTTCGGCTGCGTGCCACAAGCTGGCGCCATTGCCTAAGGTCAAAGTGCAGCAGCGACAACAGACGCCATTCGTGTCATAAATATGTATTTCAATACAGCCCAGTTTTGAAGCCAAATACAGCAGCGTCCCAATTTGTAGTGATAACTGGGCAGAAAGTATAATTGCCAATACTACGCTTTTATATAAAGTGATCTATTTTGAATTACATATATTTGTGCTATTAATTAATTAATTTCTTGTTTTATAAAGATTCAAACAAGAGATGTTCTTTTTACCAAACACTAAAATATACAAATATACTTTGATATATTACTGTGATTGACCACCGCTGTATGGGGTCCAATT GCCCTTTTCGCCCCCTAAAAATATGCCTGGAAATTGGCCTTAATCCACGCCATCCTCCGCACTCCTCCCACCAGCCGTCTGATGGCACTTTCATTCTCAGGCCGCTTGCGTACCCATCTACATATATATCCATACAGACAGACAATACATACATACACATATATATATATAGGTGGGCCTAAAGCTGTGTATATGTATATGTACTATGTGCATATACAGTATAATTCGCTTAGCTGCATCGATAGTTAGCTGCATCGGCAAGATATCTGCATTATTTTTCCATTTTTTTGTGTGAATAGAAAATAGAAAATAGAAAAAAAAAAATTAAGTTAGCTGCATTTTTAAGTTACCTGCATCGAGGCATTGTGCAAAGTACTCGAGGCAGCTAAGCGAATTATACTGTAGCTAAATTTATGCGTACGTATTTTTGGCCATGCGCGTCTCCAATTTGAACCAAAAAAAAAAGGCAAGGAAAATAAACCGAATGAAAATTGTGCCTCAATATTTTTCACCGACTCCCAGAGCGAAAGATGTATTAAAAAAAAAAAACAAGAACGAACGGAACAGCAAATTTGACACAATCCGTGGAAAACTGCGTGTTCGTGTGTTTTTTTGGGCGACACTTTGGATTTTCTCTTTTCCCGTCGCTTCGACATTCCTGCCTCATGTTTTATGCATTTGTTTTGACAATTGCTTTGGAGCGAAGCATCCCCGAATGGATTGTACACTCACCTATCATAGTTCCAACAATTAAAGCCACCCCACTGAAGAGGCCCAGCCTGAAATGACAAAAAAAAAGAGAATAATATTGTAAATTCAACGAAATTATCAAATAAATTAAAAATACTGCTTTTTGGGGTAGATTTTTAAGGTAAAGACATGATTTCATCACTCGAATCTGCATGTTAAAGTCAAAAGTCGATAAATATTGACGGATGGATGTCAAAAATAGATCCGTGTACTTGTTAATTTTGAGTATGTTAAGTAAATCACTTAATTGACAGCAAGGTGTAAATCAAGTGAATAGCGCGTTTTTAGCCA


Search Again